SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Genomic Alteration:wbgene00006789(unc-54) (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

1,575 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Species

Sort Ascending

Sort Descending

 Synonyms

Sort Ascending

Sort Descending

 Notes
Phenotype

Sort Ascending

Sort Descending

 Affected Gene

Sort Ascending

Sort Descending

 Genomic Alteration

Sort Ascending

Sort Descending

 Catalog Number
Background

Sort Ascending

Sort Descending

 Database

Sort Ascending

Sort Descending

 Database Abbreviation

Sort Ascending

Sort Descending

 Availability

Sort Ascending

Sort Descending

 Source References

Sort Ascending

Sort Descending

 Alternate IDs
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
AM134
 
Resource Report
Resource Website
1+ mentions 		RRID:WB-STRAIN:WBStrain00000180 Caenorhabditis elegans rmIs126. Made_by: S. Garcia/A Chavez|"Mutagen:Gamma Rays"|"rmIs126 [unc-54p::Q0::YFP]. Diffuse distribution of Q0::YFP throughout the body-wall muscle cells. [NOTE: (04/29/13) Strain is reported as incorrect -- apparently carries 20Q transgene. Working on obtaining a replacement.]" WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00000180 WormBase (WB) WB available PMID:38714700 WB-STRAIN:AM134, CGC_AM134 WormBase 2026-09-19 10:59:40 2
ANM48
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00000204 Caenorhabditis elegans dvIs14[unc-54/A1-42(pCL12)+mtl-2::GFP(pCL26);sod-3(gk235)X, EMPTY WBGene00004932(sod-3)|WBGene00006789(unc-54) WBGene00004932(sod-3), WBGene00006789(unc-54) WB-STRAIN:WBStrain00000204 WormBase (WB) WB unknown PMID:24988428 WB-STRAIN:ANM48 WormBase 2026-09-19 10:59:40 0
CB576
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004184 Caenorhabditis elegans unc-54(e576) I. Slow movement. WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004184 WormBase (WB) WB available PMID:7190524 WB-STRAIN:CB576, CGC_CB576 WormBase 2026-09-19 11:00:24 0
CB1201
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004270 Caenorhabditis elegans unc-54(e1201) I. Paralyzed Unc. Null allele. WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004270 WormBase (WB) WB available PMID:7190524
PMID:38302462		 WB-STRAIN:CB1201, CGC_CB1201 WormBase 2026-09-19 11:00:25 0
CB1300
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004293 Caenorhabditis elegans unc-54(e1300) I. Unc. Suppressed by sup-5 and sup-7. Null allele? Milder than most null. WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004293 WormBase (WB) WB available PMID:909083 WB-STRAIN:CB1300, CGC_CB1300 WormBase 2026-09-19 11:00:25 0
CB1301
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004294 Caenorhabditis elegans unc-54(e1301) I. Temperature sensitive Unc.|"WBStrain mapped, WBPaper00059669 added based on AFP_Strain data." WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004294 WormBase (WB) WB available PMID:909083
PMID:32449565		 WB-STRAIN:CB1301, CGC_CB1301 WormBase 2026-09-19 11:00:25 0
CB843
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004208 Caenorhabditis elegans unc-54(e843) I. Stiff. Body muscle abnormal. WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004208 WormBase (WB) WB available WB-STRAIN:CB843, CGC_CB843 WormBase 2026-09-19 11:00:24 0
CB1009
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004228 Caenorhabditis elegans unc-54(e1009) I. Paralyzed Unc. Null allele. WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004228 WormBase (WB) WB available PMID:703836 WB-STRAIN:CB1009, CGC_CB1009 WormBase 2026-09-19 11:00:24 0
CB1008
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004227 Caenorhabditis elegans unc-54(e1008) I. Unc. Suppressed by sup-5 and sup-7. WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004227 WormBase (WB) WB available PMID:703836 WB-STRAIN:CB1008, CGC_CB1008 WormBase 2026-09-19 11:00:24 0
CB1092
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004243 Caenorhabditis elegans unc-54(e1092) I. Paralyzed Unc. Null allele. WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004243 WormBase (WB) WB available PMID:7190524 WB-STRAIN:CB1092, CGC_CB1092 WormBase 2026-09-19 11:00:24 0
CB2221
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004386 Caenorhabditis elegans unc-54(e1315) I; dpy-11(e224) eDp23 V. Dpy. Movement Slow. Unc partially suppressed. WBGene00001073(dpy-11)|WBGene00006789(unc-54) WBGene00001073(dpy-11), WBGene00006789(unc-54) WB-STRAIN:WBStrain00004386 WormBase (WB) WB available PMID:669254 WB-STRAIN:CB2221, CGC_CB2221 WormBase 2026-09-19 11:00:26 0
CB2204
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004380 Caenorhabditis elegans unc-54(e190) I; eDp22 V. Movement slow. Unc partially suppressed. WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004380 WormBase (WB) WB available PMID:669254 WB-STRAIN:CB2204, CGC_CB2204 WormBase 2026-09-19 11:00:26 0
CB2203
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004379 Caenorhabditis elegans unc-54(e190) I; dpy-11(e224) eDp22 V. Dpy. Movement Slow. Unc partially suppressed. WBGene00001073(dpy-11)|WBGene00006789(unc-54) WBGene00001073(dpy-11), WBGene00006789(unc-54) WB-STRAIN:WBStrain00004379 WormBase (WB) WB available PMID:669254 WB-STRAIN:CB2203, CGC_CB2203 WormBase 2026-09-19 11:00:26 0
CB1419
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004331 Caenorhabditis elegans unc-54(e1419) I. Unc. Suppressed by sup-5 and sup-7. WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004331 WormBase (WB) WB available PMID:909083 WB-STRAIN:CB1419, CGC_CB1419 WormBase 2026-09-19 11:00:25 0
CB2784
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004419 Caenorhabditis elegans let-202(e1720) unc-54(e1092)/eDf24 I. Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). WBGene00002458(let-202)|WBGene00006789(unc-54) WBGene00002458(let-202), WBGene00006789(unc-54) WB-STRAIN:WBStrain00004419 WormBase (WB) WB available PMID:6589606 WB-STRAIN:CB2784, CGC_CB2784 WormBase 2026-09-19 11:00:26 0
CB2782
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004418 Caenorhabditis elegans let-204(e1719) unc-54(e1092)/eDf24 I. Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). WBGene00002460(let-204)|WBGene00006789(unc-54) WBGene00002460(let-204), WBGene00006789(unc-54) WB-STRAIN:WBStrain00004418 WormBase (WB) WB available PMID:6589606 WB-STRAIN:CB2782, CGC_CB2782 WormBase 2026-09-19 11:00:26 0
CB2780
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004416 Caenorhabditis elegans let-203(e1717) unc-54(e1092)/eDf24 I. Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000). WBGene00002459(let-203)|WBGene00006789(unc-54) WBGene00002459(let-203), WBGene00006789(unc-54) WB-STRAIN:WBStrain00004416 WormBase (WB) WB available PMID:6589606 WB-STRAIN:CB2780, CGC_CB2780 WormBase 2026-09-19 11:00:26 0
CB3035
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004435 Caenorhabditis elegans unc-54(e1258) I; wdDp1 V. Suppressed Unc. WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004435 WormBase (WB) WB available WB-STRAIN:CB3035, CGC_CB3035 WormBase 2026-09-19 11:00:27 0
CB3019
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004433 Caenorhabditis elegans unc-54(e1258) I; eDf1 eDp21/+ V. Movement slow. Suppressed Unc. Revertant. Heterozygotes move slowly and segregate larval lethals (eDf1 eDp21 homozygotes), and paralyzed Uncs. WBGene00006789(unc-54) WBGene00006789(unc-54) WB-STRAIN:WBStrain00004433 WormBase (WB) WB available PMID:2575705 WB-STRAIN:CB3019, CGC_CB3019 WormBase 2026-09-19 11:00:27 0
CGC61
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00004991 Caenorhabditis elegans F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F36D4.4. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: atgacaatgtctcaagggtccatgtactcccctatatcttccaaacattc Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCTCAATTTATTTGTCATTATTG" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00004991 WormBase (WB) WB available WB-STRAIN:CGC61, CGC_CGC61 WormBase 2026-09-19 11:00:33 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch