Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00029468

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00001534(gcy-7)|WBGene00001578(ges-1)|WBGene00001867(him-8)|WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00006773(unc-37)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001534(gcy-7), WBGene00001578(ges-1), WBGene00001867(him-8), WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00006773(unc-37)
Availability: available
References:
Synonyms: unc-37(ot59)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); him-8(e1489) IV; otIs3 V.
Alternate IDs: WB-STRAIN:OH4605, CGC_OH4605
Notes: Heterozygotes are WT and GFP+ in the pharynx. ot59 is homozygous inviable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. otIs3[lin-15(+) + gcy-7::GFP]. otIs3 is expressed in ASEL in WT animals. In this ot59 strain, otIs3 is expressed in ASEL and ASER.

Proper citation: RRID:WB-STRAIN:WBStrain00029468 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00029503

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00001534(gcy-7)|WBGene00001578(ges-1)|WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00006829(unc-101)|WBGene00009188(lsy-22)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001534(gcy-7), WBGene00001578(ges-1), WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00006829(unc-101), WBGene00009188(lsy-22)
Availability: available
References:
Synonyms: lsy-22(ot114) unc-101(m1) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); otIs3 V.
Alternate IDs: WB-STRAIN:OH7116, CGC_OH7116
Notes: Made_by: Eileen Flowers|"otIs3 [gcy-7::GFP + lin-15(+)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are WT and GFP+. Homozygous lsy-22(ot114) unc-101(m1) animals are Unc and have a maternal effect embryonic lethal phenotype. Whole genome sequenced strain."

Proper citation: RRID:WB-STRAIN:WBStrain00029503 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00029941

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)
Genomic Alteration: WBGene00003514(myo-2)
Availability: available
References:
Synonyms: cuIs2 IV.
Alternate IDs: WB-STRAIN:OK39, CGC_OK39
Notes: cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Rollers.|"Made_by: Christina Haun"|"Mutagen:Gamma rays"|"Supplementary_genotype Myo-2c"

Proper citation: RRID:WB-STRAIN:WBStrain00029941 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00040718

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000235(baf-1)|WBGene00000254(bli-4)|WBGene00001578(ges-1)|WBGene00002246(lag-2)|WBGene00003514(myo-2)|WBGene00003983(pes-10)
Genomic Alteration: WBGene00000235(baf-1), WBGene00000254(bli-4), WBGene00001578(ges-1), WBGene00002246(lag-2), WBGene00003514(myo-2), WBGene00003983(pes-10)
Availability: available
References:
Synonyms: baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qIs19 V.
Alternate IDs: WB-STRAIN:YG1011, CGC_YG1011
Notes: qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile and Unc). All worms express lag-2p::GFP at the distal tip cells. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

Proper citation: RRID:WB-STRAIN:WBStrain00040718 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00040720

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000235(baf-1)|WBGene00000254(bli-4)|WBGene00001578(ges-1)|WBGene00003052(lmn-1)|WBGene00003514(myo-2)|WBGene00003983(pes-10)
Genomic Alteration: WBGene00000235(baf-1), WBGene00000254(bli-4), WBGene00001578(ges-1), WBGene00003052(lmn-1), WBGene00003514(myo-2), WBGene00003983(pes-10)
Availability: available
References:
Synonyms: baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ccIs4810 X.
Alternate IDs: WB-STRAIN:YG1021, CGC_YG1021
Notes: ccIs4810 [(pJKL380.4) lmn-1p::lmn-1::GFP::lmn-1 3'utr + (pMH86) dpy-20(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express Cel-lamin::GFP (lmn-1 gene is expressed at the nuclear periphery). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

Proper citation: RRID:WB-STRAIN:WBStrain00040720 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00041121

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00028342(Cbr-lin-3)
Genomic Alteration: WBGene00003514(myo-2), WBGene00028342(Cbr-lin-3)
Availability: unknown
References:
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:JU617
Notes: Non-elegans Strain

Proper citation: RRID:WB-STRAIN:WBStrain00041121 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00041120

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00028342(Cbr-lin-3)
Genomic Alteration: WBGene00003514(myo-2), WBGene00028342(Cbr-lin-3)
Availability: unknown
References:
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:JU616
Notes: Non-elegans Strain

Proper citation: RRID:WB-STRAIN:WBStrain00041120 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00041118

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00030012(Cbr-egl-17)
Genomic Alteration: WBGene00003514(myo-2), WBGene00030012(Cbr-egl-17)
Availability: unknown
References:
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:JU610
Notes: Non-elegans Strain

Proper citation: RRID:WB-STRAIN:WBStrain00041118 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00041119

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00030720(Cbr-zmp-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00030720(Cbr-zmp-1)
Availability: unknown
References:
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:JU613
Notes: Non-elegans Strain

Proper citation: RRID:WB-STRAIN:WBStrain00041119 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00030592

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00017698(F22B7.9)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00017698(F22B7.9)
Availability: available
References:
Synonyms: mIs10 V.
Alternate IDs: WB-STRAIN:PD4793, CGC_PD4793
Notes: mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. Suppresses recombination between unc-60 and dpy-11. See WBG 15 #5 page 20.

Proper citation: RRID:WB-STRAIN:WBStrain00030592 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00030590

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00017698(F22B7.9)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00017698(F22B7.9)
Availability: available
References:
Synonyms: mIs12 II.
Alternate IDs: WB-STRAIN:PD4790, CGC_PD4790
Notes: mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3). See WBG 15 #5 page 20. See CB5584.

Proper citation: RRID:WB-STRAIN:WBStrain00030590 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00039075

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC40090, CGC_VC40090
Notes: Homozygous viable. Deletion of 1570 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATATTGTTCTTCACGCCAGGTCTACAA; Right flanking sequence: GGAGGTACCACAACGGAGGTAAATTTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00039075 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00039046

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017901(siss-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017901(siss-1)
Availability: available
References:
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC40060, CGC_VC40060
Notes: Homozygous viable. Deletion of 1917 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAATTGGAGAGAGCAGTGGACAGAGGT; Right flanking sequence: TGAGGGGAATACGCCAGGTTTCGCCAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00039046 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00035666

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002189(kin-1)|WBGene00003514(myo-2)|WBGene00003983(pes-10)
Genomic Alteration: WBGene00002189(kin-1), WBGene00003514(myo-2), WBGene00003983(pes-10)
Availability: available
References:
Synonyms: kin-1(ok338)/mIs13 I.
Alternate IDs: WB-STRAIN:VC307, CGC_VC307
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK909.2a. mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP (stronger signal represents mIs13 homozygotes, weaker signal represents ok338/mIs13) and non-GFP ok338 homozygotes (arrested embryos). Pick dim GFP WT and check for correct segregation of progeny to maintain."

Proper citation: RRID:WB-STRAIN:WBStrain00035666 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00049341

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001240(elo-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001240(elo-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: elo-2(ve602[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V.
Alternate IDs:
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. ?. Deletion of 1650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate PHENOTYPIC DESCRIPTION (ve602 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: accgggaaaaatgtgaaattgcgaaactag ; Right flanking sequence: ggagggcaaagtgtattttttaaatgattt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous unhealthy. Deletion of 1650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sickly animals that can grow up to lay small broods (ve602 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: accgggaaaaatgtgaaattgcgaaactag ; Right flanking sequence: ggagggcaaagtgtattttttaaatgattt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00049341 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00049343

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001080(dpy-21)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011687(cwc-15)
Genomic Alteration: WBGene00001080(dpy-21), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011687(cwc-15)
Availability: unknown
References:
Synonyms: cwc-15(ve604[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V.
Alternate IDs:
Notes: ?. Deletion of 1421 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ PHENOTYPIC DESCRIPTION (ve604 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aactcatattcaaaactcgcgccgaaatgt ; Right flanking sequence: gtaggccgtatcgacttttcaagtactttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous larval arrest. Deletion of 1421 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear young larvae easiest to see at the edge of the lawn (ve604 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aactcatattcaaaactcgcgccgaaatgt ; Right flanking sequence: gtaggccgtatcgacttttcaagtactttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00049343 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00049392

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006585(tni-3)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006585(tni-3), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: tni-3(ve653[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs:
Notes: Homozygous viable. Deletion of 1346 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agcacataaaaatctacaaaaagatcacca ; Right flanking sequence: cctggaaaagttgatctgtgagaagtggca. sgRNA #1: GGAGGAAGAGGAATAAgaag; sgRNA #2: tttggcggggaaaaatgacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00049392 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00049391

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: T20D3.5(ve652[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC5 IV.
Alternate IDs:
Notes: Homozygous sterile. Deletion of 1274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults(ve652 homozygotes) and Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: gatgcaattcaacaaatcaaattggaaggc ; Right flanking sequence: aactcaccggacgtataagtctaacttgat. sgRNA #1: caaatcaaattggaaggcgt; sgRNA #2: tatacgtccggtgagttcaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00049391 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00049395

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: +/nT1 [umnIs49] IV; F53F1.2(ve656[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V.
Alternate IDs:
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults that lay dead eggs (ve656 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids)."|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults that lay dead eggs (ve656 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aataacttttgctgtccgctcattcctgat ; Right flanking sequence: tcgcaatattccgctataatatctttagtt. sgRNA #1: gaatcgaggtcagtcgcatc; sgRNA #2: atagcggaatattgcgagag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00049395 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00049398

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000181(ard-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000181(ard-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: ard-1(ve659[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC5 IV.
Alternate IDs:
Notes: Homozygous sterile, Pvl. Deletion of 3031 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Sterile Pvl (ve659 homozygotes) and Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: cacttatgatttaggtaaacgggaacaaAT ; Right flanking sequence: ctccttgtactctgggatctatattcataa. sgRNA #1: aggtaaacgggaacaaATGT; sgRNA #2: tcccagagtacaaggagaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous sterile, Pvl. Deletion of 3031 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Sterile, Pvl adults (ve659 homozygotes) and Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: cacttatgatttaggtaaacgggaacaaAT ; Right flanking sequence: ctccttgtactctgggatctatattcataa. sgRNA #1: aggtaaacgggaacaaATGT; sgRNA #2: tcccagagtacaaggagaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00049398 Copy   

•   Source: Integrated Animals