SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 1,575 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00004991

http://www.wormbase.org/db/get?name=WBStrain00004991

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Synonyms: F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC61, CGC_CGC61
Notes: Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F36D4.4. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: atgacaatgtctcaagggtccatgtactcccctatatcttccaaacattc Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCTCAATTTATTTGTCATTATTG"

Proper citation: RRID:WB-STRAIN:WBStrain00004991 Copy   


  • RRID:WB-STRAIN:WBStrain00004989

http://www.wormbase.org/db/get?name=WBStrain00004989

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008737(gnrr-7)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008737(gnrr-7)
Availability: available
Synonyms: gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:CGC59, CGC_CGC59
Notes: Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of gnrr-7. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ATATTTATTTAATATATATTTTGTTCTGGTTTAAAGCCGCAAAGTCTTGG Right flanking sequence: AGGGTACCATCAAGCAATGGCATTCTGGTTGCCCTTAAGCATAACAATTG"

Proper citation: RRID:WB-STRAIN:WBStrain00004989 Copy   


  • RRID:WB-STRAIN:WBStrain00004988

http://www.wormbase.org/db/get?name=WBStrain00004988

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Synonyms: C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC58, CGC_CGC58
Notes: Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C54E10.3. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tctccgcctaaaaaaatatatgtacccccgatgggattcgaacctgtggc Right flanking sequence: GGGTATGCAAAATGACCGCGTTTTCTGTGAATTCATCGTCATGCTTTATT"

Proper citation: RRID:WB-STRAIN:WBStrain00004988 Copy   


  • RRID:WB-STRAIN:WBStrain00005002

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005002

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021328(npr-23)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021328(npr-23)
Availability: available
Synonyms: npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs: WB-STRAIN:CGC72, CGC_CGC72
Notes: Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of npr-23. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: cccctgcctctggctcccacaaggcgtcatctggagagaagaacgaagtg Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGCGTTGCTCGTATTGGTGCCGG"

Proper citation: RRID:WB-STRAIN:WBStrain00005002 Copy   


  • RRID:WB-STRAIN:WBStrain00005081

http://www.wormbase.org/db/get?name=WBStrain00005081

Source Database: WormBase (WB)
Affected Genes: WBGene00003474(mtl-2)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003474(mtl-2), WBGene00006789(unc-54)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx121 [pCL12 (unc-54/b 1-42) + pCL26
Alternate IDs: WB-STRAIN:CL1121
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005081 Copy   


  • RRID:WB-STRAIN:WBStrain00005094

    This resource has 10+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005094

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:7568134, PMID:9751195, PMID:32966472, PMID:34707479, PMID:36226991, PMID:36653384, PMID:37103980, PMID:37522064, PMID:37113386, PMID:37549461, PMID:38983916, PMID:38991033, PMID:39950089
Synonyms: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Alternate IDs: WB-STRAIN:CL2006, CGC_CL2006
Notes: dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062076 paper added based on AFP_Strain data."|"[2020-08-03T18:23:09.013Z WBPerson324] Ressurect Strain: Paper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]"

Proper citation: RRID:WB-STRAIN:WBStrain00005094 Copy   


  • RRID:WB-STRAIN:WBStrain00005093

http://www.wormbase.org/db/get?name=WBStrain00005093

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: unknown
Source References: PMID:7568134, PMID:9751195
Synonyms: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Alternate IDs: WB-STRAIN:CL2005
Notes: [2020-08-03T18:27:21.884Z WBPerson324] Ressurect Strain: WBPaper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]

Proper citation: RRID:WB-STRAIN:WBStrain00005093 Copy   


  • RRID:WB-STRAIN:WBStrain00005007

http://www.wormbase.org/db/get?name=WBStrain00005007

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Synonyms: C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Alternate IDs: WB-STRAIN:CGC78, CGC_CGC78
Notes: Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C04C3.6. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttgaaaatttgaaatttgaaaaaaatcaactatttttaatgaaaatttca Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGTTCATCGTGCTTCGAAAGTAC"

Proper citation: RRID:WB-STRAIN:WBStrain00005007 Copy   


  • RRID:WB-STRAIN:WBStrain00006164

http://www.wormbase.org/db/get?name=WBStrain00006164

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Synonyms: unc-54(m37) I.
Alternate IDs: WB-STRAIN:DR37, CGC_DR37
Notes: Healthy. Recessive. Dauer recovery slow. Eggs laid rarely.

Proper citation: RRID:WB-STRAIN:WBStrain00006164 Copy   


  • RRID:WB-STRAIN:WBStrain00006158

http://www.wormbase.org/db/get?name=WBStrain00006158

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Synonyms: unc-54(m31) I.
Alternate IDs: WB-STRAIN:DR31, CGC_DR31
Notes: Severe Unc. Very slow growth. Strong semi-dominant. Heterozygous males don't mate.

Proper citation: RRID:WB-STRAIN:WBStrain00006158 Copy   


  • RRID:WB-STRAIN:WBStrain00006197

http://www.wormbase.org/db/get?name=WBStrain00006197

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006789(unc-54)
Availability: available
Synonyms: unc-54(e1258) I; dpy-11(e224) wdDp1 V.
Alternate IDs: WB-STRAIN:DR119, CGC_DR119
Notes: DPY.

Proper citation: RRID:WB-STRAIN:WBStrain00006197 Copy   


  • RRID:WB-STRAIN:WBStrain00006286

http://www.wormbase.org/db/get?name=WBStrain00006286

Source Database: WormBase (WB)
Affected Genes: WBGene00006354(sus-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00006354(sus-1), WBGene00006789(unc-54)
Availability: available
Source References: PMID:4018568
Synonyms: unc-54(e190) I; sus-1(m156) III.
Alternate IDs: WB-STRAIN:DR631, CGC_DR631
Notes: Made_by: Brown S|"Severly paralyzed Unc. More severe than unc-15 alone."

Proper citation: RRID:WB-STRAIN:WBStrain00006286 Copy   


  • RRID:WB-STRAIN:WBStrain00006244

http://www.wormbase.org/db/get?name=WBStrain00006244

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001867(him-8), WBGene00006789(unc-54)
Availability: available
Synonyms: unc-54(m36) I; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:DR290, CGC_DR290
Notes: Severe Unc. Segregates males. M-MATING-NO SUCCESS. Semi-dominant. Heterozygotes are slow moving.

Proper citation: RRID:WB-STRAIN:WBStrain00006244 Copy   


  • RRID:WB-STRAIN:WBStrain00006253

http://www.wormbase.org/db/get?name=WBStrain00006253

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:2575705
Synonyms: unc-54(e190) I; eDf1 eDp21/+ V.
Alternate IDs: WB-STRAIN:DR405, CGC_DR405
Notes: Made_by:

Proper citation: RRID:WB-STRAIN:WBStrain00006253 Copy   


  • RRID:WB-STRAIN:WBStrain00027251

http://www.wormbase.org/db/get?name=WBStrain00027251

Source Database: WormBase (WB)
Affected Genes: WBGene00000253(bli-3)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000253(bli-3), WBGene00006789(unc-54)
Availability: available
Synonyms: bli-3(e767) unc-54(e1092) I.
Alternate IDs: WB-STRAIN:MT6183, CGC_MT6183
Notes: Mapping strain.

Proper citation: RRID:WB-STRAIN:WBStrain00027251 Copy   


  • RRID:WB-STRAIN:WBStrain00027091

http://www.wormbase.org/db/get?name=WBStrain00027091

Source Database: WormBase (WB)
Affected Genes: WBGene00000415(ced-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000415(ced-1), WBGene00006789(unc-54)
Availability: available
Source References: PMID:1936965
Synonyms: ced-1(e1735) unc-54(e1092) I.
Alternate IDs: WB-STRAIN:MT3778, CGC_MT3778
Notes: Unc. Abnormal cell death.

Proper citation: RRID:WB-STRAIN:WBStrain00027091 Copy   


  • RRID:WB-STRAIN:WBStrain00004184

http://www.wormbase.org/db/get?name=WBStrain00004184

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:7190524
Synonyms: unc-54(e576) I.
Alternate IDs: WB-STRAIN:CB576, CGC_CB576
Notes: Slow movement.

Proper citation: RRID:WB-STRAIN:WBStrain00004184 Copy   


  • RRID:WB-STRAIN:WBStrain00004270

http://www.wormbase.org/db/get?name=WBStrain00004270

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:7190524, PMID:38302462
Synonyms: unc-54(e1201) I.
Alternate IDs: WB-STRAIN:CB1201, CGC_CB1201
Notes: Paralyzed Unc. Null allele.

Proper citation: RRID:WB-STRAIN:WBStrain00004270 Copy   


  • RRID:WB-STRAIN:WBStrain00004293

http://www.wormbase.org/db/get?name=WBStrain00004293

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:909083
Synonyms: unc-54(e1300) I.
Alternate IDs: WB-STRAIN:CB1300, CGC_CB1300
Notes: Unc. Suppressed by sup-5 and sup-7. Null allele? Milder than most null.

Proper citation: RRID:WB-STRAIN:WBStrain00004293 Copy   


  • RRID:WB-STRAIN:WBStrain00004294

http://www.wormbase.org/db/get?name=WBStrain00004294

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:909083, PMID:32449565
Synonyms: unc-54(e1301) I.
Alternate IDs: WB-STRAIN:CB1301, CGC_CB1301
Notes: Temperature sensitive Unc.|"WBStrain mapped, WBPaper00059669 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00004294 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X