Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00004991
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Synonyms: F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC61, CGC_CGC61
Notes: Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F36D4.4. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: atgacaatgtctcaagggtccatgtactcccctatatcttccaaacattc Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCTCAATTTATTTGTCATTATTG"
Proper citation: RRID:WB-STRAIN:WBStrain00004991 Copy
http://www.wormbase.org/db/get?name=WBStrain00004989
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008737(gnrr-7)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008737(gnrr-7)
Availability: available
Synonyms: gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:CGC59, CGC_CGC59
Notes: Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of gnrr-7. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ATATTTATTTAATATATATTTTGTTCTGGTTTAAAGCCGCAAAGTCTTGG Right flanking sequence: AGGGTACCATCAAGCAATGGCATTCTGGTTGCCCTTAAGCATAACAATTG"
Proper citation: RRID:WB-STRAIN:WBStrain00004989 Copy
http://www.wormbase.org/db/get?name=WBStrain00004988
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Synonyms: C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC58, CGC_CGC58
Notes: Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C54E10.3. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tctccgcctaaaaaaatatatgtacccccgatgggattcgaacctgtggc Right flanking sequence: GGGTATGCAAAATGACCGCGTTTTCTGTGAATTCATCGTCATGCTTTATT"
Proper citation: RRID:WB-STRAIN:WBStrain00004988 Copy
http://www.wormbase.org/db/get?name=WBStrain00005002
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021328(npr-23)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021328(npr-23)
Availability: available
Synonyms: npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs: WB-STRAIN:CGC72, CGC_CGC72
Notes: Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of npr-23. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: cccctgcctctggctcccacaaggcgtcatctggagagaagaacgaagtg Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGCGTTGCTCGTATTGGTGCCGG"
Proper citation: RRID:WB-STRAIN:WBStrain00005002 Copy
http://www.wormbase.org/db/get?name=WBStrain00005081
Source Database: WormBase (WB)
Affected Genes: WBGene00003474(mtl-2)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003474(mtl-2), WBGene00006789(unc-54)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx121 [pCL12 (unc-54/b 1-42) + pCL26
Alternate IDs: WB-STRAIN:CL1121
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005081 Copy
http://www.wormbase.org/db/get?name=WBStrain00005094
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:7568134, PMID:9751195, PMID:32966472, PMID:34707479, PMID:36226991, PMID:36653384, PMID:37103980, PMID:37522064, PMID:37113386, PMID:37549461, PMID:38983916, PMID:38991033, PMID:39950089
Synonyms: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Alternate IDs: WB-STRAIN:CL2006, CGC_CL2006
Notes: dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062076 paper added based on AFP_Strain data."|"[2020-08-03T18:23:09.013Z WBPerson324] Ressurect Strain: Paper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]"
Proper citation: RRID:WB-STRAIN:WBStrain00005094 Copy
http://www.wormbase.org/db/get?name=WBStrain00005093
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: unknown
Source References: PMID:7568134, PMID:9751195
Synonyms: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Alternate IDs: WB-STRAIN:CL2005
Notes: [2020-08-03T18:27:21.884Z WBPerson324] Ressurect Strain: WBPaper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Proper citation: RRID:WB-STRAIN:WBStrain00005093 Copy
http://www.wormbase.org/db/get?name=WBStrain00005007
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Synonyms: C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Alternate IDs: WB-STRAIN:CGC78, CGC_CGC78
Notes: Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C04C3.6. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttgaaaatttgaaatttgaaaaaaatcaactatttttaatgaaaatttca Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGTTCATCGTGCTTCGAAAGTAC"
Proper citation: RRID:WB-STRAIN:WBStrain00005007 Copy
http://www.wormbase.org/db/get?name=WBStrain00006164
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Synonyms: unc-54(m37) I.
Alternate IDs: WB-STRAIN:DR37, CGC_DR37
Notes: Healthy. Recessive. Dauer recovery slow. Eggs laid rarely.
Proper citation: RRID:WB-STRAIN:WBStrain00006164 Copy
http://www.wormbase.org/db/get?name=WBStrain00006158
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Synonyms: unc-54(m31) I.
Alternate IDs: WB-STRAIN:DR31, CGC_DR31
Notes: Severe Unc. Very slow growth. Strong semi-dominant. Heterozygous males don't mate.
Proper citation: RRID:WB-STRAIN:WBStrain00006158 Copy
http://www.wormbase.org/db/get?name=WBStrain00006197
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006789(unc-54)
Availability: available
Synonyms: unc-54(e1258) I; dpy-11(e224) wdDp1 V.
Alternate IDs: WB-STRAIN:DR119, CGC_DR119
Notes: DPY.
Proper citation: RRID:WB-STRAIN:WBStrain00006197 Copy
http://www.wormbase.org/db/get?name=WBStrain00006286
Source Database: WormBase (WB)
Affected Genes: WBGene00006354(sus-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00006354(sus-1), WBGene00006789(unc-54)
Availability: available
Source References: PMID:4018568
Synonyms: unc-54(e190) I; sus-1(m156) III.
Alternate IDs: WB-STRAIN:DR631, CGC_DR631
Notes: Made_by: Brown S|"Severly paralyzed Unc. More severe than unc-15 alone."
Proper citation: RRID:WB-STRAIN:WBStrain00006286 Copy
http://www.wormbase.org/db/get?name=WBStrain00006244
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001867(him-8), WBGene00006789(unc-54)
Availability: available
Synonyms: unc-54(m36) I; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:DR290, CGC_DR290
Notes: Severe Unc. Segregates males. M-MATING-NO SUCCESS. Semi-dominant. Heterozygotes are slow moving.
Proper citation: RRID:WB-STRAIN:WBStrain00006244 Copy
http://www.wormbase.org/db/get?name=WBStrain00006253
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:2575705
Synonyms: unc-54(e190) I; eDf1 eDp21/+ V.
Alternate IDs: WB-STRAIN:DR405, CGC_DR405
Notes: Made_by:
Proper citation: RRID:WB-STRAIN:WBStrain00006253 Copy
http://www.wormbase.org/db/get?name=WBStrain00027251
Source Database: WormBase (WB)
Affected Genes: WBGene00000253(bli-3)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000253(bli-3), WBGene00006789(unc-54)
Availability: available
Synonyms: bli-3(e767) unc-54(e1092) I.
Alternate IDs: WB-STRAIN:MT6183, CGC_MT6183
Notes: Mapping strain.
Proper citation: RRID:WB-STRAIN:WBStrain00027251 Copy
http://www.wormbase.org/db/get?name=WBStrain00027091
Source Database: WormBase (WB)
Affected Genes: WBGene00000415(ced-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000415(ced-1), WBGene00006789(unc-54)
Availability: available
Source References: PMID:1936965
Synonyms: ced-1(e1735) unc-54(e1092) I.
Alternate IDs: WB-STRAIN:MT3778, CGC_MT3778
Notes: Unc. Abnormal cell death.
Proper citation: RRID:WB-STRAIN:WBStrain00027091 Copy
http://www.wormbase.org/db/get?name=WBStrain00004184
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:7190524
Synonyms: unc-54(e576) I.
Alternate IDs: WB-STRAIN:CB576, CGC_CB576
Notes: Slow movement.
Proper citation: RRID:WB-STRAIN:WBStrain00004184 Copy
http://www.wormbase.org/db/get?name=WBStrain00004270
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:7190524, PMID:38302462
Synonyms: unc-54(e1201) I.
Alternate IDs: WB-STRAIN:CB1201, CGC_CB1201
Notes: Paralyzed Unc. Null allele.
Proper citation: RRID:WB-STRAIN:WBStrain00004270 Copy
http://www.wormbase.org/db/get?name=WBStrain00004293
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:909083
Synonyms: unc-54(e1300) I.
Alternate IDs: WB-STRAIN:CB1300, CGC_CB1300
Notes: Unc. Suppressed by sup-5 and sup-7. Null allele? Milder than most null.
Proper citation: RRID:WB-STRAIN:WBStrain00004293 Copy
http://www.wormbase.org/db/get?name=WBStrain00004294
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:909083, PMID:32449565
Synonyms: unc-54(e1301) I.
Alternate IDs: WB-STRAIN:CB1301, CGC_CB1301
Notes: Temperature sensitive Unc.|"WBStrain mapped, WBPaper00059669 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00004294 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.