Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 99 showing 1961 ~ 1980 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00050686

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bqSi447 II; bqSi495 IV; ygIs1.
Notes: bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421|"Made_by: Jennifer Harr"

Proper citation: RRID:WB-STRAIN:WBStrain00050686 Copy   


http://www.wormbase.org/db/get?name=WBStrain00050685

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bqsi433 II; bqSi495 IV; ygIs1.
Notes: bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421|"Made_by: Jennifer Harr"

Proper citation: RRID:WB-STRAIN:WBStrain00050685 Copy   


http://www.wormbase.org/db/get?name=WBStrain00050684

Source Database: WormBase (WB)
Affected Genes: WBGene00019883(met-2)
Genomic Alteration: WBGene00019883(met-2)
Availability: unknown
Source References: EMPTY
Synonyms: met-2(gw1419[met-2::FLAG::TEV::mCherry]) III.
Notes: Made_by: Micol Guidi|"Superficially wild-type. Endogenously tagged met-2 locus, with MET-2::mCherry signal detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265"

Proper citation: RRID:WB-STRAIN:WBStrain00050684 Copy   


http://www.wormbase.org/db/get?name=WBStrain00050683

Source Database: WormBase (WB)
Affected Genes: WBGene00003082(lsm-8)|WBGene00003514(myo-2)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003082(lsm-8), WBGene00003514(myo-2), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: lsm-8 (xe17[myo-2p::mCherry::unc-54 3'UTR]) IV/nT1 [qIs51] (IV;V); pkIs1582 V/nT1 [qIs51] (IV;V).
Notes: Made_by: Florian Aeschlimann|"pkIs1582 [let-858::GFP + rol-6(su1006)] V. Homozygous lethal lsm-8 deletion balanced by GFP-marked nT1 translocation. xe17 generated by CRISPR/Cas9-engineered replacement of the gene with a red pharyngeal marker. lsm-8 heterozygotes are wild-type (will roll in this case because of pkIs1582) green & red pharynx, and will segregate rolling heterozygotes (green & red pharynx), arrested nT1[qIs51] aneuploids (only green pharynx), and lsm-8 homozygotes (only red pharynx). Homozygous nT1[qIs51] inviable. Pick rollers with green & red pharynx and check for correct segregation of progeny to maintain. Reference: Mattout A, et al. Nat Cell Biol. 2020 May;22(5):579-590. PMID: 32251399"

Proper citation: RRID:WB-STRAIN:WBStrain00050683 Copy   


http://www.wormbase.org/db/get?name=WBStrain00050721

Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)|WBGene00016485(meg-4)
Genomic Alteration: WBGene00001569(meg-3), WBGene00016485(meg-4)
Availability: unknown
Source References: EMPTY
Synonyms: meg-3(ax3051[meg-3::OLLAS]) meg-4(ax3052) X.
Notes: P granule size reduced, detection of MEG-3 by anti-OLLAS antibody. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.

Proper citation: RRID:WB-STRAIN:WBStrain00050721 Copy   


http://www.wormbase.org/db/get?name=WBStrain00050727

Source Database: WormBase (WB)
Affected Genes: WBGene00022257(puf-11)
Genomic Alteration: WBGene00022257(puf-11)
Availability: unknown
Source References: EMPTY
Synonyms: puf-11(q1128[3xV5::puf-11]) IV.
Notes: 3x V5 epitope tags inserted into endogenous puf-11 locus. Expresses functional 3x V5-tagged PUF-11. Reference: Haupt KA, Genetics. 2020 Jan;214(1):147-161. PMID: 31740451

Proper citation: RRID:WB-STRAIN:WBStrain00050727 Copy   


http://www.wormbase.org/db/get?name=WBStrain00050671

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002225(klp-15)|WBGene00002226(klp-16)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002225(klp-15), WBGene00002226(klp-16)
Availability: unknown
Source References: EMPTY
Synonyms: klp-15(ok1958) klp-16(or1952)/tmC18[dpy-5(tmIs1236)] I; ltIs37 IV; ruIs57.
Notes: itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020|"ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020"

Proper citation: RRID:WB-STRAIN:WBStrain00050671 Copy   


http://www.wormbase.org/db/get?name=WBStrain00050674

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002225(klp-15)|WBGene00002226(klp-16)|WBGene00004027(pie-1)|WBGene00006843(unc-119)|WBGene00008107(aspm-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002225(klp-15), WBGene00002226(klp-16), WBGene00004027(pie-1), WBGene00006843(unc-119), WBGene00008107(aspm-1)
Availability: unknown
Source References: EMPTY
Synonyms: klp-15(ok1958) aspm-1(syb1260[gfp::aspm-1]) klp-16(or1952) /tmC18[dpy-5(tmIs1236)] I; ltIs37[pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV
Notes: itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020|"ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020"

Proper citation: RRID:WB-STRAIN:WBStrain00050674 Copy   


http://www.wormbase.org/db/get?name=WBStrain00050673

Source Database: WormBase (WB)
Affected Genes: WBGene00006994(zyg-9)
Genomic Alteration: WBGene00006994(zyg-9)
Availability: unknown
Source References: EMPTY
Synonyms: zyg-9(or1956[gfp::zyg-9]) II; ltIs37 IV.
Notes: itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020|"ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020"

Proper citation: RRID:WB-STRAIN:WBStrain00050673 Copy   


http://www.wormbase.org/db/get?name=WBStrain00050678

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: gwIs39 gwIs34 unc-119(ed3) III.
Notes: gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs34 [myo-3::mCherry + 256xlacO + unc-119(+)] III. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364

Proper citation: RRID:WB-STRAIN:WBStrain00050678 Copy   


  • RRID:WB-STRAIN:WBStrain00050711

http://www.wormbase.org/db/get?name=WBStrain00050711

Source Database: WormBase (WB)
Affected Genes: WBGene00003746(nlp-8)
Genomic Alteration: WBGene00003746(nlp-8)
Availability: unknown
Source References: EMPTY
Synonyms: nlp-8(syb762) IV.
Notes: Made_by: Marina Sinner /SunyBiotech|"syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791"

Proper citation: RRID:WB-STRAIN:WBStrain00050711 Copy   


http://www.wormbase.org/db/get?name=WBStrain00050716

Source Database: WormBase (WB)
Affected Genes: WBGene00004323(rde-1)
Genomic Alteration: WBGene00004323(rde-1)
Availability: unknown
Source References: EMPTY
Synonyms: frSi21 II; frIs7 IV; rde-1(ne300) V.
Notes: frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454|"frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the inserted vector but outside the genomic rde-1 sequence included in the transgene (jep3108: ATcttgtgaccgaactgtcc) in combination with downstream primer (jep2445: caaaaaggcgggatgagcag), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. Reference: https:"

Proper citation: RRID:WB-STRAIN:WBStrain00050716 Copy   


  • RRID:WB-STRAIN:WBStrain00050714

http://www.wormbase.org/db/get?name=WBStrain00050714

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34865044
Synonyms: osIs158 II; ieSi58 IV.
Notes: Made_by: Takefumi Negishi|"osIs158 [eft-3p::ccvTIR-1(F79G)::mRuby] single copy inserted into ttTi5605 on LG II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218."|"osIs158 [eft-3p::ccvTIR-1(F79G)::mRuby] single copy inserted into ttTi5605 on LG II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Yesbolatova A, et al. Nat Commun. 2020 Nov 11;11(1):5701."

Proper citation: RRID:WB-STRAIN:WBStrain00050714 Copy   


  • RRID:WB-STRAIN:WBStrain00050713

http://www.wormbase.org/db/get?name=WBStrain00050713

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: cshIs128 II; ieSi58 IV.
Notes: cshIs128 [rps-28p::TIR1::T2A::mCherry::his-11 + Cbr-unc-119(+)] II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Companion strain to HML1012. Harbors conventional allele of TIR1 and Nuclear localized mCherry co-expression marker.|"Made_by: Nat"

Proper citation: RRID:WB-STRAIN:WBStrain00050713 Copy   


  • RRID:WB-STRAIN:WBStrain00050719

http://www.wormbase.org/db/get?name=WBStrain00050719

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38839826
Synonyms: wrdSi46 I.
Notes: wrdSi46 [SCMp*::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Seam cell-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in seam cell nuclei. Some expression in hypodermal cells. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541|"wrdSi46[SCMp*::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR] I:-5.32 Seam cell-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in seam cell nuclei. Some expression in hypodermal cells. Reference Ashley et al., 2020"

Proper citation: RRID:WB-STRAIN:WBStrain00050719 Copy   


  • RRID:WB-STRAIN:WBStrain00050660

http://www.wormbase.org/db/get?name=WBStrain00050660

Source Database: WormBase (WB)
Affected Genes: WBGene00003564(ncs-2)
Genomic Alteration: WBGene00003564(ncs-2)
Availability: unknown
Source References: PMID:38530893
Synonyms: ncs-2(ju836)
Notes: Superficially wild-type. Reference: Zhou K, et al. Cell Reports 2017 May 9;19(6):1117-1129. PMID: 28494862

Proper citation: RRID:WB-STRAIN:WBStrain00050660 Copy   


  • RRID:WB-STRAIN:WBStrain00050662

http://www.wormbase.org/db/get?name=WBStrain00050662

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: uqIs5.
Notes: uqIs5 [lbp-2p::lbp-2::TagRFP]. Age-dependent aggregation of LBP-2::TagRFP in the pseudocoelom. Reference: Gallotta I, et al. Nature. 2020 Jul 8. doi: 10.1038/s41586-020-2461-z.

Proper citation: RRID:WB-STRAIN:WBStrain00050662 Copy   


http://www.wormbase.org/db/get?name=WBStrain00050661

Source Database: WormBase (WB)
Affected Genes: WBGene00004272(rab-8)
Genomic Alteration: WBGene00004272(rab-8)
Availability: unknown
Source References: EMPTY
Synonyms: rab-8(tm2526) I; muIs32 II.
Notes: muIs32 [mec-7p::GFP + lin-15(+)]. Homozygous viable. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420

Proper citation: RRID:WB-STRAIN:WBStrain00050661 Copy   


  • RRID:WB-STRAIN:WBStrain00050701

http://www.wormbase.org/db/get?name=WBStrain00050701

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: goeIs397.
Notes: goeIs397 [hsp-16.2p::cnc-10::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-10::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791|"Made_by: Florentin Masurat"

Proper citation: RRID:WB-STRAIN:WBStrain00050701 Copy   


  • RRID:WB-STRAIN:WBStrain00050667

http://www.wormbase.org/db/get?name=WBStrain00050667

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi170 I.
Notes: bmdSi170 [loxN::eft-3p::his-58::GFP::3xHA] I. Superficially wild-type. bmdSi170 is a single-copy CRISPR/Cas9-engineered insertion of HIS-58 C-terminally tagged with non-codon-optimized GFP and driven by the ubiquitous eft-3 promoter. Reference: Azmi MA, et al. bioRxiv 2020.10.17.344069; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00050667 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X