Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Adh5em1Mcwi Resource Report Resource Website |
RRID:RGD_152998996 | Rattus norvegicus | This model was generated at the Medical College of Wisconsin by CRISPR/Cas9 mutagenesis in Crl:SD strain and harbors a 16-bp deletion in exon 3 of Adh5. rn6.0:chr2:226,979,096-226,979,111. contact MCW Rat Distribution at [email protected] | 152998996 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2022-07-15) | 152998996 | 2026-07-25 12:43:14 | 0 | |||||
|
SD-Ager em2Mcwi Resource Report Resource Website |
RRID:RGD_152998993 | Rattus norvegicus | This model was produced at the Medical College of Wisconsin using CRISPR/Cas9 in the Crl:SD strain. The resulting mutation is a 1-bp insertion in the third exon of the Ager gene. rn6.0:chr20:4,150,403-4,150,403 ins T contact MCW Rat Distribution at [email protected] | 152998993 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2022-07-15) | 152998993 | 2026-07-25 12:43:14 | 0 | |||||
|
SD-Galtem3Mcwi+/- Resource Report Resource Website |
RRID:RGD_632645231 | Rattus norvegicus | This is a heterozygous Galt mutant rat carries one copy of CRISPR/Cas9 system induced 2-base pair insertion mutation into exon 6 in the rat Galt gene of Crl:SD embryos. | 632645231 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 632645231 | 2026-07-25 12:43:14 | 0 | |||||
|
WI-Ugt2em1Yakaz Resource Report Resource Website |
RRID:RGD_625777899 | Rattus norvegicus | To produce Ugt2 cluster (∼762-kb) KO rats, two gRNAs with target sites upstream of Ugt2a1 and the coding region of Ugt2b31-like were injected into rat fertilized eggs. A knockout strain with Ugt2 cluster mutation carried concatenation of the genomic sequence upstream of Ugt2a1, a 102-bp insertion, and the Ugt2b31-like region. The F2 homozygous rats showed decreased gemfibrozil glucuronidation activity in the liver. The result suggested the functional deletion of rat Ugt2 genes in the Ugt2-KO rats. | 625777899 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 625777899 | 2026-07-25 12:43:14 | 0 | |||||
|
LE-Cdkl5em1Sidb Resource Report Resource Website |
RRID:RGD_626170603 | Rattus norvegicus | In collaboration with Horizon Discovery, CRISPR/Cas9 technology was used in Long Evans (LE) embryos to introduce a 10bp deletion in exon 8 of the Cdkl5 gene (Ensembl coordinates X:35,674,763–35,674,772, in the Rnor_6.0 genome assembly) which results in the introduction of an early stop codon in constitutive exon 9, leading to lack of CDKL5 protein expression. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]). | 626170603 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-09-02) | 626170603 | 2026-07-25 12:43:14 | 0 | |||||
|
LE-Elovl4 em1cgen-/- Resource Report Resource Website |
RRID:RGD_617154644 | Rattus norvegicus | The CRISPR/Cas9 genetic editing approach was used to generate .a homozygous Long-Evans rat model of human SCA34. The human Cas9 D10A (hCas9-D10A) nickase was used to knock-in the c.736T>G mutation by targeting exon 6 of the rat Elovl4 (Ensembl: ENSRNOG00000009773) located on rat chromosome 8. The hCas9 mRNA, sgRNA(CCTTCCCCAAGTGGATGCAC), and single-strand oligonucleotide donor (ssODN: TTCCATGTGACCATTGGGCACACAGCACTGTCTCTCTACACCGACTGCCCCTTCCCCAAGGGGATGCACTGGGCTCTGATCGCCTATGCCATCAGCTTCATCTTCCTCTTCCTCAACTTCTAC) were co-injected into Long-Evans rat zygotes at the laboratories of Cyagen Bioscience Inc.The heterozygous F0 rats carrying c.736T>G, p.W246G, mutation were bred with with WT Long-Evans rats over several generations to breed out any potential off-target effects and to establish the heterozygous SCA34 Long-Evans rat model. Successfully generation of homozygous SCA34 rats (MUT) by breeding heterozygous rats from the different F0 lines. | 617154644 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 617154644 | 2026-07-25 12:43:14 | 0 | |||||
|
SD-Dp(Sult1a1-Spn)/YahIcsOrl Resource Report Resource Website |
RRID:RGD_626168271 | Rattus norvegicus | Sprague Dawley rat. Tandem duplication of the genetic interval between Sult1a1 and Spn genes using CRISPR/Cas9 engineering. We targeted the genetic interval borders from one allele and the CRISPR/Cas9 system allowed us to cut and transpose those sequences to the same locus on the second allele. Heterozygous animals are Overweight and hypoactivity. European Mouse Mutant Archive(EMMA) | 626168271 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryorecovery (as of 2025-08-29) | 626168271 | 2026-07-25 12:43:14 | 0 | |||||
|
LE-Elovl4 em1cgen-/+ Resource Report Resource Website |
RRID:RGD_617154642 | Rattus norvegicus | The CRISPR/Cas9 genetic editing approach was used to generate .a heterozygous Long-Evans rat model of human SCA34. The human Cas9 D10A (hCas9-D10A) nickase was used to knock-in the c.736T>G mutation by targeting exon 6 of the rat Elovl4 (Ensembl: ENSRNOG00000009773) located on rat chromosome 8. The hCas9 mRNA, sgRNA(CCTTCCCCAAGTGGATGCAC), and single-strand oligonucleotide donor (ssODN: TTCCATGTGACCATTGGGCACACAGCACTGTCTCTCTACACCGACTGCCCCTTCCCCAAGGGGATGCACTGGGCTCTGATCGCCTATGCCATCAGCTTCATCTTCCTCTTCCTCAACTTCTAC) were co-injected into Long-Evans rat zygotes at the laboratories of Cyagen Bioscience Inc.The heterozygous F0 rats carrying c.736T>G, p.W246G, mutation were bred with with WT Long-Evans rats over several generations to breed out any potential off-target effects and to establish the heterozygous SCA34 Long-Evans rat model. Successfully generation of homozygous SCA34 rats (MUT) by breeding heterozygous rats from the different F0 lines. | 617154642 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 617154642 | 2026-07-25 12:43:14 | 0 | |||||
|
LH-C17h6orf52em1Aek Resource Report Resource Website |
RRID:RGD_156431061 | Rattus norvegicus | The CRISPR/Cas9 system was used to introduce a T insertion in exon 1 of C17h6orf52 gene causing a frameshift and predicated early truncation of the translated protein in an embryo from LH/MavRrrcAek (RGD:10755352) through electroporation. Currently live colony with Dr. Anne Kwitek at the Medical College of Wisconsin. Being cryopreserved and the live colony will not be available. | 156431061 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2026-01-15) | 156431061 | 2026-07-25 12:43:14 | 0 | |||||
|
SD-Peg3em1Soar Resource Report Resource Website |
RRID:RGD_626168261 | Rattus norvegicus | Crispr/Cas9 genome editing of the Peg3 gene The strain is deposit at RRRC - University of Missouri | 626168261 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-08-29) | 626168261 | 2026-07-25 12:43:14 | 0 | |||||
|
SS-Sdhaem1Mcwi Resource Report Resource Website |
RRID:RGD_13506177 | Rattus norvegicus | CRISPR/SpCas9 targeting was used to introduce an 11-bp putative frame-shift deletion in exon 3. Contact MCW rat distribution at [email protected] | 13506177 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2018-01-31) | 13506177 | 2026-07-25 12:43:14 | 0 | |||||
|
LE-Syngap1em2Sidb Resource Report Resource Website |
RRID:RGD_626170595 | Rattus norvegicus | This allele has a deletion of the C2/GAP domain of Syngap1 and was generated by Sigma Advanced Genetic Engineering (SAGE) Labs (St. Louis, MO, US). Zinc-finger nucleases (ZFNs) designed to target Syngap1 exons 8–12 were microinjected into the pronucleus of fertilized, single-cell Long Evans (LE) embryos. A 3,584-bp selective deletion and 3-bp insertion were confirmed by sequencing, which resulted in a mutant protein that was 377 amino acids smaller than endogenous SYNGAP1. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]). | 626170595 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-09-02) | 626170595 | 2026-07-25 12:43:14 | 0 | |||||
|
SD-Mpoem1Lempo Resource Report Resource Website |
RRID:RGD_632518398 | Rattus norvegicus | The CRISPR/Cas9 system was multiplexed to introduce a double strand brake at exon 3 and 14 to promote the removal of majority of the MPO gene in rat embryos. Animal Modeling Core at the University of Missouri. Availability Contact Email: [email protected] | 632518398 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2026-02-12) | 632518398 | 2026-07-25 12:43:14 | 0 | |||||
|
SD-Gsapem2mcwi Resource Report Resource Website |
RRID:RGD_153297754 | Rattus norvegicus | This strain was produced at the Medical College of Wisconsin using CRISPR Cas9 mutagenesis in the Crl:SD strain. A CRISPR SpCas9/sgRNA targeting the GTCCTTTGCAGTCCCTGCCG sequence within exon 15 of Gsap and a 5-bp indel (rn72: chr4:13,849,488-13,849,492) was identified. | 153297754 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2022-07-21) | 153297754 | 2026-07-25 12:43:14 | 0 | |||||
|
SD-Gnalem3Hpng Resource Report Resource Website |
RRID:RGD_626419679 | Rattus norvegicus | Crl:CD(SD)-KO(Gnal*135)44-178Hpng/Hpng rats were generated by CRISPR/Cas9 technology. A deletion of 135 base pairs, corresponding to position 44-178, downstream of the translation initiation start ATG of the Gnal splicing variant 2, results in a deletion mutation. CRISPR technology details: self-synthesized Cas9 mRNA using px 330 vector, applying T7 transcription kit followed by Poly-Adenylation and Capping. No sequencing performed, whether Cas9 has been inserted into the rat genome is unknown. European Mouse Mutant Archive(EMMA) | 626419679 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2025-09-05) | 626419679 | 2026-07-25 12:43:14 | 0 | |||||
|
LE-Pdynem(iCre)1Ottc Resource Report Resource Website |
RRID:RGD_405100724 | Rattus norvegicus | This mutant rat was produced by targeted knocking adding in IRES-iCre to the 3' end of Pdyn in LE rat using CRISPR/Cas9 method. Optogenetics and Transgenic Technology Core | 405100724 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405100724 | 2026-07-25 12:43:13 | 0 | |||||
|
SD-CdCSem1Bcgen+/+ Resource Report Resource Website |
RRID:RGD_616572761 | Rattus norvegicus | This is the wild type littermate of SD-CdCSem1Bcgen+/- (RGD:616390066). The mutant CdCS rat has the 5p15.2 deletion in the genome and it a rat model for human Cri du Chat Syndrome . | 616572761 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 616572761 | 2026-07-25 12:43:14 | 0 | |||||
|
SD-Galtem3Mcwi-/- Resource Report Resource Website |
RRID:RGD_13441560 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 2-base pair insertion mutation into exon 6 in the rat Galt gene of Crl:SD embryos | 13441560 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13441560 | 2026-07-25 12:43:14 | 0 | |||||
|
WI-Nr1i2em1Yakaz Resource Report Resource Website |
RRID:RGD_625777904 | Rattus norvegicus | To produce Pxr KO rats, A pair of TALEN mRNAs targeting Nr1i2 (Pxr) was injected into rat fertilized eggs.This strain was derived from a founder harbouring a16 bp deletion (rPxr-KO). | 625777904 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 625777904 | 2026-07-25 12:43:14 | 0 | |||||
|
WI-Cyp3aem58Yakaz Resource Report Resource Website |
RRID:RGD_625777901 | Rattus norvegicus | To produce Cyp3a (∼560-kb) KO rats, A pair of TALEN mRNAs targeting exon 5 of rat Cyp3a23/3a1 and Cyp3a2 were injected into rat fertilized eggs. A founder with homozygous big deletion (BD) mutation from No. 58 line selected. | 625777901 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 625777901 | 2026-07-25 12:43:14 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
