Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=329951705
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm; Cryorecovery (as of 2023-07-10)
References:
Synonyms:
Alternate IDs: RGD_329951705, 329951705, RRRC_807, RRRC_0807, RRRC_00807
Notes: Deletion of coding sequence (Exon 2) using CRISPR/Cas9 Rat Resource and Research Center
Proper citation: RRID:RRRC_00807 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=329951706
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2023-07-10)
References:
Synonyms:
Alternate IDs: RGD_329951706, 329951706, RRRC_861, RRRC_0861, RRRC_00861
Notes: CRISPR/Cas9-mediated deletion of ATG start site in Exon 2 of Adrm1 gene Rat Resource and Research Center
Proper citation: RRID:RRRC_00861 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=155900755
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-02-09)
References:
Synonyms:
Alternate IDs: RGD_155900755, 155900755, RRRC_984, RRRC_0984, RRRC_00984
Notes: Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous GG nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. The laboratory has deposited these strains with the Rat Resource and Research Center
Proper citation: RRID:RRRC_00984 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2306711
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm
References:
Synonyms:
Alternate IDs: RGD_2306711, 2306711, RRRC_475, RRRC_0475, RRRC_00475
Notes: this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb Rat Resource & Research Center
Proper citation: RRID:RRRC_00475 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=401827145
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryorecovery (as of 2025-01-27)
References:
Synonyms:
Alternate IDs: RGD_401827145, 401827145, RRRC_1007, RRRC_01007
Notes: The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. The rat is deposited at Rat Resource and Research Center (RRRC).
Rat Resource and Research Center
Proper citation: RRID:RRRC_01007 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=151356946
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_151356946, 151356946, RRRC_953, RRRC_0953, RRRC_00953
Notes: Two DNA expression constructs, the bacterial tetracyclin repressor (TetR) under the expression control of human EEF1A1 promoter and the improved Cre recombinase (iCre) under Fos promoter were joined in an antiparallel orientation in one rat ROSA26 targeting cassette. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. The DNA construct, together with CRISPR /Cas9 system, was injected to one cell Long-Evans (Crl:LE) rat embryos and founders were identified and bred for 8 generations at at NIDA IRP (Hope lab). Rat Resource and Research Center
Proper citation: RRID:RRRC_00953 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=13602097
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_13602097, 13602097, RRRC_834, RRRC_0834, RRRC_00834
Notes: This mutant strain was created using highly efficient CRISPR-Cas9-mediated homology-directed repair (HDR) in rat spermatogonial stem cell cultures. The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of CRISPR associated protein 9 (Cas9) catalytic mutant protein D10A under the control of CAG promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.The resulting mutant rats in Prague-Dawley background was backcrossed with WT LE for three or four generations for studies. Rat Resource and Research Center
Proper citation: RRID:RRRC_00834 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=405855876
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_405855876, 405855876, RRRC_957, RRRC_0957, RRRC_00957
Notes: This Foxo4 mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. Rat Resource and Research Center
Proper citation: RRID:RRRC_00957 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=152999003
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_152999003, 152999003, RRRC_960, RRRC_0960, RRRC_00960
Notes: Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9 Rat Resource and Research Center
Proper citation: RRID:RRRC_00960 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=155782907
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm; Cryorecovery (as of 2025-05-13)
References:
Synonyms:
Alternate IDs: RGD_155782907, 155782907, RRRC_964, RRRC_0964, RRRC_00964
Notes: Exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in rat by CRISPR/Cas9 system in the outbred LE embryos. It is similar to RRRC strain #1025 (LE-Synpoem2Kmh) (RGD:616335891), has a different mutation. This strain is deposited at Rat Resource and Research Center,
Proper citation: RRID:RRRC_00964 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=152999023
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-05-21)
References:
Synonyms:
Alternate IDs: RGD_152999023, 152999023, RRRC_965, RRRC_0965, RRRC_00965
Notes: Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using
CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the
EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine
teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately
downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just
downstream of the translational start site were used. Rat Resource and Research Center
Proper citation: RRID:RRRC_00965 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=14695031
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_14695031, 14695031, RRRC_845, RRRC_0845, RRRC_00845
Notes: This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.0kb 5' and 1.8kb 3' homology arms and a FRT-CAG-Pac-FRT cassette. The FRT-CAG-Pac-FRT cassette is inserted into the intron between Il2rg 4th and 5th exon. No genomic sequence is deleted. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain. Rat Resource and Research Center
Proper citation: RRID:RRRC_00845 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=14695030
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_14695030, 14695030, RRRC_846, RRRC_0846, RRRC_00846
Notes: This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 5.8kb 5' and 1.7kb 3' homology arms. A G843D point mutation is introduced into the Pex1 gene. The 12th and 13th exons are flanked with two loxP sites. A FRT-CAG-Pac-FRT cassette is inserted into the intron between Pex1 13th and 14th exon. This strain mimics the Peroxisomal Disorders. Heterozygote does not show any abnormalities. Rat Resource and Research Center
Proper citation: RRID:RRRC_00846 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=598973845
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_598973845, 598973845, RRRC_932, RRRC_0932, RRRC_00932
Notes: The targeted mutation in the rat GFAP gene was based on the severity and frequency of the R239H mutation in human disease. The CRISPR/Cas9 system was used to mediated knockin of point mutation (R237H) to Sprague-Dawley embryos. The current background srain is Crl:CD (SD). This mutant strain serves as a model for Alexander disease. knockins have post-weaning failure to thrive and ~10% mortality by 12 weeks, but afterwards are viable and can breed . The strain is now deposited at Rat Resource and Research Center
Proper citation: RRID:RRRC_00932 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=150526809
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_150526809, 150526809, RRRC_940, RRRC_0940, RRRC_00940
Notes: This spontaneous mutant strain was originally derived from King Holtzman background and now maintained in Sprague Dawley background. A single nucleotide mutation was identified in the androgen receptor gene. The tfm males are sterile so the mutation is carried via females who breed normally. Rat Resource and Research Center
Proper citation: RRID:RRRC_00940 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=150521608
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_150521608, 150521608, RRRC_881, RRRC_0881, RRRC_00881
Notes: CRISPR/Cas9 system was used to introduce an
inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. Rat Resource and Research Center
Proper citation: RRID:RRRC_00881 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=13208223
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_13208223, 13208223, RRRC_924, RRRC_0924, RRRC_00924
Notes: The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Rat Resource and Research Center
Proper citation: RRID:RRRC_00924 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=405100723
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo (as of 2025-08-29)
References:
Synonyms:
Alternate IDs: RGD_405100723, 405100723, RRRC_1022, RRRC_01022
Notes: The CRISPR/Case9 knock-in of CAG-LSL-Ghsr (LSL: loxp-Stop-Loxp) to the ROSA 26 locus of LE rats has cre recombinase-dependent expression of rat Ghsr under the control of CAG promoter. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Rat Resource and Research Center
Proper citation: RRID:RRRC_01022 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=14695002
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_14695002, 14695002, RRRC_850, RRRC_0850, RRRC_00850
Notes: The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 1bp-insertion (206_207insT) in exon 4. No protein expression was detected in the brain. Rat Resource and Research Center
Proper citation: RRID:RRRC_00850 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=14695003
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: RGD_14695003, 14695003, RRRC_851, RRRC_0851, RRRC_00851
Notes: The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 300 bp-deletion(c.205_505del) in exon 4. No protein expression was detected in the brain. Rat Resource and Research Center
Proper citation: RRID:RRRC_00851 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
