Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
F344-FM117003Tn(sb-T2/Bart3)2.321McwiRrrc Resource Report Resource Website |
RRID:RRRC_00475 | Rattus norvegicus | this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb Rat Resource & Research Center | 00475 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Sperm | RGD_2306711, 2306711, RRRC_475, RRRC_0475, RRRC_00475 | 2026-07-25 02:42:06 | 0 | |||||
|
LE-Pink1em1Davis Resource Report Resource Website |
RRID:RRRC_01007 | Rattus norvegicus | The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. The rat is deposited at Rat Resource and Research Center (RRRC). Rat Resource and Research Center | 01007 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryorecovery (as of 2025-01-27) | RGD_401827145, 401827145, RRRC_1007, RRRC_01007 | 2026-07-25 02:42:08 | 0 | |||||
|
LE-ROSA26em1(EEF1A1-TetR, Fos-iCre)/BhopeRrrc Resource Report Resource Website |
RRID:RRRC_00953 | Rattus norvegicus | Two DNA expression constructs, the bacterial tetracyclin repressor (TetR) under the expression control of human EEF1A1 promoter and the improved Cre recombinase (iCre) under Fos promoter were joined in an antiparallel orientation in one rat ROSA26 targeting cassette. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. The DNA construct, together with CRISPR /Cas9 system, was injected to one cell Long-Evans (Crl:LE) rat embryos and founders were identified and bred for 8 generations at at NIDA IRP (Hope lab). Rat Resource and Research Center | 00953 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_151356946, 151356946, RRRC_953, RRRC_0953, RRRC_00953 | 2026-07-25 02:42:08 | 0 | |||||
|
LE.Cg-(ROSA26) em1(CAG-Cas9*D10A)Ottc Resource Report Resource Website 1+ mentions |
RRID:RRRC_00834 | Rattus norvegicus | This mutant strain was created using highly efficient CRISPR-Cas9-mediated homology-directed repair (HDR) in rat spermatogonial stem cell cultures. The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of CRISPR associated protein 9 (Cas9) catalytic mutant protein D10A under the control of CAG promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.The resulting mutant rats in Prague-Dawley background was backcrossed with WT LE for three or four generations for studies. Rat Resource and Research Center | 00834 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_13602097, 13602097, RRRC_834, RRRC_0834, RRRC_00834 | 2026-07-25 02:42:07 | 1 | |||||
|
SD-Foxo4em1Soar Resource Report Resource Website |
RRID:RRRC_00957 | Rattus norvegicus | This Foxo4 mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. Rat Resource and Research Center | 00957 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_405855876, 405855876, RRRC_957, RRRC_0957, RRRC_00957 | 2026-07-25 02:42:08 | 0 | |||||
|
LE-Fxn em1Fara-/+/Rrrc Resource Report Resource Website |
RRID:RRRC_00960 | Rattus norvegicus | Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9 Rat Resource and Research Center | 00960 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_152999003, 152999003, RRRC_960, RRRC_0960, RRRC_00960 | 2026-07-25 02:42:08 | 0 | |||||
|
LE-Synpoem1Kmh Resource Report Resource Website 1+ mentions |
RRID:RRRC_00964 | Rattus norvegicus | Exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in rat by CRISPR/Cas9 system in the outbred LE embryos. It is similar to RRRC strain #1025 (LE-Synpoem2Kmh) (RGD:616335891), has a different mutation. This strain is deposited at Rat Resource and Research Center, | 00964 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Sperm; Cryorecovery (as of 2025-05-13) | RGD_155782907, 155782907, RRRC_964, RRRC_0964, RRRC_00964 | 2026-07-25 02:42:08 | 1 | |||||
|
SD-Aif1tm(EGFP)Apps/Mmmc Resource Report Resource Website |
RRID:RRRC_00965 | Rattus norvegicus | Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just downstream of the translational start site were used. Rat Resource and Research Center | 00965 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-05-21) | RGD_152999023, 152999023, RRRC_965, RRRC_0965, RRRC_00965 | 2026-07-25 02:42:08 | 0 | |||||
|
SD.DA-Il2rgTm(G843D-FRT-CAG-Pac-FRT)1Qly Resource Report Resource Website |
RRID:RRRC_00845 | Rattus norvegicus | This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.0kb 5' and 1.8kb 3' homology arms and a FRT-CAG-Pac-FRT cassette. The FRT-CAG-Pac-FRT cassette is inserted into the intron between Il2rg 4th and 5th exon. No genomic sequence is deleted. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain. Rat Resource and Research Center | 00845 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_14695031, 14695031, RRRC_845, RRRC_0845, RRRC_00845 | 2026-07-25 02:42:08 | 0 | |||||
|
SD.DA-Pex1tm(G843D-FRT-CAG-Pac-FRT)1Qly Resource Report Resource Website |
RRID:RRRC_00846 | Rattus norvegicus | This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 5.8kb 5' and 1.7kb 3' homology arms. A G843D point mutation is introduced into the Pex1 gene. The 12th and 13th exons are flanked with two loxP sites. A FRT-CAG-Pac-FRT cassette is inserted into the intron between Pex1 13th and 14th exon. This strain mimics the Peroxisomal Disorders. Heterozygote does not show any abnormalities. Rat Resource and Research Center | 00846 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_14695030, 14695030, RRRC_846, RRRC_0846, RRRC_00846 | 2026-07-25 02:42:07 | 0 | |||||
|
SD-Gfapem1Mes+/- Resource Report Resource Website 1+ mentions |
RRID:RRRC_00932 | Rattus norvegicus | The targeted mutation in the rat GFAP gene was based on the severity and frequency of the R239H mutation in human disease. The CRISPR/Cas9 system was used to mediated knockin of point mutation (R237H) to Sprague-Dawley embryos. The current background srain is Crl:CD (SD). This mutant strain serves as a model for Alexander disease. knockins have post-weaning failure to thrive and ~10% mortality by 12 weeks, but afterwards are viable and can breed . The strain is now deposited at Rat Resource and Research Center | 00932 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_598973845, 598973845, RRRC_932, RRRC_0932, RRRC_00932 | 2026-07-25 02:42:08 | 3 | |||||
|
SD-Artfm/Rrrc Resource Report Resource Website |
RRID:RRRC_00940 | Rattus norvegicus | This spontaneous mutant strain was originally derived from King Holtzman background and now maintained in Sprague Dawley background. A single nucleotide mutation was identified in the androgen receptor gene. The tfm males are sterile so the mutation is carried via females who breed normally. Rat Resource and Research Center | 00940 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_150526809, 150526809, RRRC_940, RRRC_0940, RRRC_00940 | 2026-07-25 02:42:08 | 0 | |||||
|
SD-Lrp5em3Vari/Rrrc Resource Report Resource Website |
RRID:RRRC_00881 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. Rat Resource and Research Center | 00881 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_150521608, 150521608, RRRC_881, RRRC_0881, RRRC_00881 | 2026-07-25 02:42:08 | 0 | |||||
|
LE-ROSA26em1(LTR-nLuc)Ottc Resource Report Resource Website |
RRID:RRRC_00924 | Rattus norvegicus | The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Rat Resource and Research Center | 00924 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_13208223, 13208223, RRRC_924, RRRC_0924, RRRC_00924 | 2026-07-25 02:42:07 | 0 | |||||
|
LE-ROSA26 em1(CAG-Ghsr)Ottc Resource Report Resource Website |
RRID:RRRC_01022 | Rattus norvegicus | The CRISPR/Case9 knock-in of CAG-LSL-Ghsr (LSL: loxp-Stop-Loxp) to the ROSA 26 locus of LE rats has cre recombinase-dependent expression of rat Ghsr under the control of CAG promoter. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Rat Resource and Research Center | 01022 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Embryo (as of 2025-08-29) | RGD_405100723, 405100723, RRRC_1022, RRRC_01022 | 2026-07-25 02:42:08 | 0 | |||||
|
SD-L1camem1Jgn Resource Report Resource Website |
RRID:RRRC_00850 | Rattus norvegicus | The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 1bp-insertion (206_207insT) in exon 4. No protein expression was detected in the brain. Rat Resource and Research Center | 00850 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_14695002, 14695002, RRRC_850, RRRC_0850, RRRC_00850 | 2026-07-25 02:42:08 | 0 | |||||
|
SD-L1camem2Jgn Resource Report Resource Website |
RRID:RRRC_00851 | Rattus norvegicus | The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 300 bp-deletion(c.205_505del) in exon 4. No protein expression was detected in the brain. Rat Resource and Research Center | 00851 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_14695003, 14695003, RRRC_851, RRRC_0851, RRRC_00851 | 2026-07-25 02:42:08 | 0 | |||||
|
SD-Trim63em1(hiLuc)/Rrrc Resource Report Resource Website |
RRID:RRRC_00731 | Rattus norvegicus | The use of zinc finger nuclease technology (ZFN) to knockin a luciferase reporter directly downstream of MuRF1 (Trim63) coding sequences in rats,leaving endogenous MuRF1 gene expression intact and bicistro-nically linking it to the inserted reporter through a hepatitis CIRES (HCV-IRES). The resulting knockin rat line, MuRF1-hiLUCs, has reporter characteristics that are fully reflective ofendogenous MuRF1 gene expression, can be used as a universalbiomarker of skeletal muscle atrophyin vivo, and has abioluminescent readout compatible with whole animal imagingmodalities. Rat Resource and Research Center | 00731 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_14695085, 14695085, RRRC_731, RRRC_0731, RRRC_00731 | 2026-07-25 02:42:07 | 0 | |||||
|
SD-Sdhbem1Ast Resource Report Resource Website |
RRID:RRRC_00853 | Rattus norvegicus | This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 4 bp-deletion in Sdhb. Rat Resource and Research Center | 00853 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_14694998, 14694998, RRRC_853, RRRC_0853, RRRC_00853 | 2026-07-25 02:42:07 | 0 | |||||
|
SD-Sdhbem3Ast Resource Report Resource Website |
RRID:RRRC_00855 | Rattus norvegicus | This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 15 bp-deletion in Sdhb. Rat Resource and Research Center | 00855 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Unknown | RGD_14695000, 14695000, RRRC_855, RRRC_0855, RRRC_00855 | 2026-07-25 02:42:07 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
