Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00036760
Source Database: WormBase (WB)
Affected Genes: WBGene00000906(daf-10)
Genomic Alteration: WBGene00000906(daf-10)
Availability: available
Source References: EMPTY
Synonyms: daf-10(gk795) IV.
Alternate IDs: WB-STRAIN:VC1641, CGC_VC1641
Notes: F23B2.4. External left primer: TGCAATACCCCAAATTGGTT. External right primer: AGTTTGGTTGAGATCGTCCG. Internal left primer: TTATTGACGGTTCCTCGGTC. Internal right primer: GCTGATCGCCCATATCTCAT. Internal WT amplicon: 1963 bp. Deletion size: 834 bp. Deletion left flank: TTAAACTAATATTTGCGGTAAAATATGTAC. Deletion right flank: CCAAAAAAAAAAACTGTTCCCCATGGAAGC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036760 Copy
http://www.wormbase.org/db/get?name=WBStrain00036800
Source Database: WormBase (WB)
Affected Genes: WBGene00017794(mltn-13)
Genomic Alteration: WBGene00017794(mltn-13)
Availability: available
Source References: PMID:38177158
Synonyms: mltn-13(gk807) X.
Alternate IDs: WB-STRAIN:VC1697, CGC_VC1697
Notes: F15A8.7. External left primer: TTGGGCCTGAGACCTTATTG. External right primer: CCCCCTCAAACTCAAGCATA. Internal left primer: AGCCTGATCCGATTTCAATG. Internal right primer: TCAACTGTGGTCATTTCGGA. Internal WT amplicon: 2295 bp. Deletion size: 960 bp. Deletion left flank: AAAAAATATTCCATTCGAAAGTAATTCGTA. Deletion right flank: ACTCTGAAAAATACATTTACTTAACATTCA. Insertion Sequence: ATA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036800 Copy
http://www.wormbase.org/db/get?name=WBStrain00036766
Source Database: WormBase (WB)
Affected Genes: WBGene00006775(unc-39)
Genomic Alteration: WBGene00006775(unc-39)
Availability: available
Source References: EMPTY
Synonyms: unc-39(gk765) V.
Alternate IDs: WB-STRAIN:VC1647, CGC_VC1647
Notes: F56A12.1. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAGACAAGGATAGCACGCAA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: TTTACGACTTGGCAGCTGGT. Internal WT amplicon: 2117 bp. Deletion size: 1130 bp. Deletion left flank: AGGTGCCTCCCCCTCTTGGACTGTTGTACC. Deletion right flank: TTCCGCAAGTATCTGATATAGAACTTTACA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036766 Copy
http://www.wormbase.org/db/get?name=WBStrain00036770
Source Database: WormBase (WB)
Affected Genes: WBGene00003689(nhr-99)
Genomic Alteration: WBGene00003689(nhr-99)
Availability: available
Source References: EMPTY
Synonyms: nhr-99(gk791) V.
Alternate IDs: WB-STRAIN:VC1655, CGC_VC1655
Notes: M02H5.1. External left primer: CTCTCAACTCCCCGTCCTTA. External right primer: TATCTCGACTGCCACGACAC. Internal left primer: GAACTATTCAAGCCCGGACA. Internal right primer: TGCGCTATTTCTCCTCCCTA. Internal WT amplicon: 1709 bp. Deletion size: 638 bp. Deletion left flank: CAGGGCGTGTGCCATGTTTTTCAGGTGGGT. Deletion right flank: TTTCACGCTGTGGCAAGATGATTTCCTGAA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036770 Copy
http://www.wormbase.org/db/get?name=WBStrain00036738
Source Database: WormBase (WB)
Affected Genes: WBGene00003606(nhr-7)
Genomic Alteration: WBGene00003606(nhr-7)
Availability: available
Source References: EMPTY
Synonyms: nhr-7(gk763) IV.
Alternate IDs: WB-STRAIN:VC1617, CGC_VC1617
Notes: F54D1.4. External left primer: CAGATGGTGGAGGAACTGGT. External right primer: GGTTTTGACACCTCTCCGAA. Internal left primer: CGAATTCGAGATGCCAGATT. Internal right primer: TCACGCATTGTTCGAAAGTT. Internal WT amplicon: 1953 bp. Deletion size: 1329 bp. Deletion left flank: ATATTGAAGTCTTGTTTCTACTGTGTTTGA. Deletion right flank: ACAAAAGCAAAAATTACCCTTGAAGAAAAA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036738 Copy
http://www.wormbase.org/db/get?name=WBStrain00036732
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00002196(kin-10)
Genomic Alteration: WBGene00000254(bli-4), WBGene00002196(kin-10)
Availability: available
Source References: EMPTY
Synonyms: kin-10(ok2031) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1609, CGC_VC1609
Notes: Mutagen:UV/TMP|"T01G9.6. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2031 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCGCAAAATTTCACGTTT. External right primer: TTCGACAGAAAACTGCTGGA. Internal left primer: GTGACGAAGACAGGCACAAA. Internal right primer: TTCACCCAACCTGTACCCAT. Internal WT amplicon: 2149 bp. Deletion size: 966 bp. Deletion left flank: AGTCGTGTTGTTTTGTGCTGCGGCAACGTT. Deletion right flank: TGGAAGCATTGGCTGATTTTCACAGTAGAC."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036732 Copy
http://www.wormbase.org/db/get?name=WBStrain00036731
Source Database: WormBase (WB)
Affected Genes: WBGene00005006(spr-1)
Genomic Alteration: WBGene00005006(spr-1)
Availability: available
Source References: EMPTY
Synonyms: spr-1(gk734) V.
Alternate IDs: WB-STRAIN:VC1608, CGC_VC1608
Notes: D1014.8. External left primer: TTGTTGGACGAGGTACTCCC. External right primer: AGGCTTCATGCAGCTTGTTT. Internal left primer: GGACGATTCATCGCGTTATT. Internal right primer: TTCAGAACAGCATTTCCGGT. Internal WT amplicon: 1855 bp. Deletion size: 1317 bp. Deletion left flank: ATACTAAAAACATAAATTTGATTATTAAAA. Deletion right flank: AGGAAACATGTTTTTATTTTATTTTTAGAA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036731 Copy
http://www.wormbase.org/db/get?name=WBStrain00036746
Source Database: WormBase (WB)
Affected Genes: WBGene00017014(dylt-2)
Genomic Alteration: WBGene00017014(dylt-2)
Availability: available
Source References: PMID:38302462
Synonyms: dylt-2(gk762) X.
Alternate IDs: WB-STRAIN:VC1625, CGC_VC1625
Notes: D1009.5. External left primer: TGAAAAATTGCGAACACCAA. External right primer: AGTCTGATTCTGGCGCTGTT. Internal left primer: TTTATGGAGAGATGGCCGAG. Internal right primer: GTCATTTCCATTGCTCCGAT. Internal WT amplicon: 1735 bp. Deletion size: 1182 bp. Deletion left flank: GAATCCCACTCTCTTCAGTTCTTTTTAATT. Deletion right flank: TTTCAAGAAATAGAGGAATCACAATAATTT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036746 Copy
http://www.wormbase.org/db/get?name=WBStrain00036748
Source Database: WormBase (WB)
Affected Genes: WBGene00010186(nhr-283)
Genomic Alteration: WBGene00010186(nhr-283)
Availability: available
Source References: EMPTY
Synonyms: nhr-283(gk764) V.
Alternate IDs: WB-STRAIN:VC1628, CGC_VC1628
Notes: F57A10.6. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1323 bp. Deletion left flank: TTCTGATATCCCAGGAAGGCCTGAAAAATT. Deletion right flank: GTTAATTTTTTTAAAATCCCAGCTCAAAAA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036748 Copy
http://www.wormbase.org/db/get?name=WBStrain00036740
Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00004786(sex-1)
Genomic Alteration: WBGene00003056(lon-2), WBGene00004786(sex-1)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; sex-1(ok2071)/szT1 X.
Alternate IDs: WB-STRAIN:VC1619, CGC_VC1619
Notes: F44A6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2071 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGGACTGGACCTACAGAGGG. External right primer: GGCAGCAACATCTACAGCAA. Internal left primer: TGTGTTGGAATGAAAACGGA. Internal right primer: AGGGACCAGATCAGTTGTGC. Internal WT amplicon: 3077 bp. Deletion size: 2408 bp. Deletion left flank: TACTAAGTCGATTCAATTCATGAATACATT. Deletion right flank: CACAGTCTTTTTACCACGCCTACATCGCAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036740 Copy
http://www.wormbase.org/db/get?name=WBStrain00036743
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00002889(let-765)
Genomic Alteration: WBGene00000254(bli-4), WBGene00002889(let-765)
Availability: available
Source References: EMPTY
Synonyms: let-765(ok2058) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1622, CGC_VC1622
Notes: F20H11.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2058 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAATCGTATTGCTGCTTCCA. External right primer: CGGAGCTGGTGTAGGAAAAG. Internal left primer: GTCCATTCGAATCTTTCCGA. Internal right primer: TGCTGAACGTGATCTTCGAG. Internal WT amplicon: 3229 bp. Deletion size: 1540 bp. Deletion left flank: CACAGATTCTAGATGAAGTGATAAAATCCG. Deletion right flank: TTTTGAAGTTCTAAGACCATTCGTCCAGTT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036743 Copy
http://www.wormbase.org/db/get?name=WBStrain00036742
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00012059(T26G10.1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00012059(T26G10.1)
Availability: available
Source References: EMPTY
Synonyms: T26G10.1(ok2057) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1621, CGC_VC1621
Notes: T26G10.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2057 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCACCATCAGCAATATCCA. External right primer: TCCGTTGGACTTTCCAATTC. Internal left primer: TTTTGTCGTCGCTTCTTTCC. Internal right primer: AAGTGTCGTCAGATTGCGTG. Internal WT amplicon: 2101 bp. Deletion size: 1183 bp. Deletion left flank: AGTCGGAAAATTCAAAATCTAACCTAAATT. Deletion right flank: CTCTGAAGACAATTAACCAGTTATTTCAGT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036742 Copy
http://www.wormbase.org/db/get?name=WBStrain00036745
Source Database: WormBase (WB)
Affected Genes: WBGene00018845(F54H12.5)|WBGene00018846(eef-1B.1)
Genomic Alteration: WBGene00018845(F54H12.5), WBGene00018846(eef-1B.1)
Availability: available
Source References: EMPTY
Synonyms: F54H12.5&F54H12.6(ok2133) III.
Alternate IDs: WB-STRAIN:VC1624, CGC_VC1624
Notes: F54H12.6, F54H12.5. Superficially wild type. External left primer: TTGGATGGTCTTCTTCTGGG. External right primer: CGAAAATGAATGGGAGGAGA. Internal left primer: TGGAGTGGAAATTTCTTCCG. Internal right primer: CATGGGGTTTCGACAGACTT. Internal WT amplicon: 2179 bp. Deletion size: 1993 bp. Deletion left flank: AACCACGGTAACGGTCTCGACACGACAAGT. Deletion right flank: CTTTTCAGGAGTGAAACACGAAGGAATGAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036745 Copy
http://www.wormbase.org/db/get?name=WBStrain00036713
Source Database: WormBase (WB)
Affected Genes: WBGene00007620(ocrl-1)|WBGene00007621(C16C2.4)
Genomic Alteration: WBGene00007620(ocrl-1), WBGene00007621(C16C2.4)
Availability: available
Source References: EMPTY
Synonyms: C16C2.4&ocrl-1(gk752) I.
Alternate IDs: WB-STRAIN:VC1587, CGC_VC1587
Notes: C16C2.4, C16C2.3. External left primer: TGTTAGCTGCTGAATCACGG. External right primer: TGCACTTGAATCTGGACAGC. Internal left primer: GAAGTCCTTGCCACGGTAAA. Internal right primer: CCTACAATTCCGAGTGCCAT. Internal WT amplicon: 1898 bp. Deletion size: 1465 bp. Deletion left flank: TCTTTCCAGCGTCCTTCGCATATTCAAAAA. Deletion right flank: AAATAAAGAAAATATTAAACAAAATCGTTG. Insertion Sequence: AA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036713 Copy
http://www.wormbase.org/db/get?name=WBStrain00036716
Source Database: WormBase (WB)
Affected Genes: WBGene00003614(nhr-15)
Genomic Alteration: WBGene00003614(nhr-15)
Availability: available
Source References: EMPTY
Synonyms: nhr-15(gk744) V.
Alternate IDs: WB-STRAIN:VC1592, CGC_VC1592
Notes: F33E11.1. External left primer: GGACACACGTTCATAATGCG. External right primer: ACTTGACGGGAATGTTTTCG. Internal left primer: GGGCTCCACATCTTTGCTTA. Internal right primer: ATGTTATGAAGGTGGCCGAG. Internal WT amplicon: 2369 bp. Deletion size: 2143 bp. Deletion left flank: CGTTTGTCCCGTTGTCCCGTTTTTTGAGTG. Deletion right flank: GTGAAATTTGATGCAGATAAAATTTTGTAA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036716 Copy
http://www.wormbase.org/db/get?name=WBStrain00036718
Source Database: WormBase (WB)
Affected Genes: WBGene00003172(mec-8)
Genomic Alteration: WBGene00003172(mec-8)
Availability: available
Source References: PMID:37603562
Synonyms: mec-8(ok2043) I.
Alternate IDs: WB-STRAIN:VC1594, CGC_VC1594
Notes: F46A9.6. Superficially wild type. External left primer: ATAGCAAGTGTGTGAGGGGG. External right primer: CCGACACAACATTCGACATC. Internal left primer: CCTCGATCGTTGGCTGTTAT. Internal right primer: ATTTCTTTGTCGCCCCTTTT. Internal WT amplicon: 2265 bp. Deletion size: 1117 bp. Deletion left flank: TCGTTGGCTGTTATCTGGAATCCTTGTAGT. Deletion right flank: TGTTGCTCATTGAAAAGAGCTGCTGATTGA.|"Mutagen:UV/TMP"|"Supplementary_genotype mec-8 (ok2043) I"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036718 Copy
http://www.wormbase.org/db/get?name=WBStrain00036717
Source Database: WormBase (WB)
Affected Genes: WBGene00013795(nhr-229)
Genomic Alteration: WBGene00013795(nhr-229)
Availability: available
Source References: EMPTY
Synonyms: nhr-229(gk743) IV.
Alternate IDs: WB-STRAIN:VC1593, CGC_VC1593
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.18. External left primer: CAAAAATGTTTTGTGCGTGG. External right primer: TCAAATCTGCGTGCTCATTC. Internal left primer: AATTACCCGCATGTTTGAGC. Internal right primer: CCGCTCAGAAATCATTCGTT. Internal WT amplicon: 1761 bp. Deletion size: 722 bp. Deletion left flank: TTTTCTCTGCTTCCCTGCGCGTCCTCAAAC. Deletion right flank: CATTCTCAAATAGAAACAGTTTTTTAACCA. Insertion Sequence: CATTTTCGTAGCGTTTTTCTCTTGCTTTACATCCTTTTCCAAACTTGCGATTCTATAAA TAAAAAATTTGAATGA."|"Y116A8C.18. External left primer: CAAAAATGTTTTGTGCGTGG. External right primer: TCAAATCTGCGTGCTCATTC. Internal left primer: AATTACCCGCATGTTTGAGC. Internal right primer: CCGCTCAGAAATCATTCGTT. Internal WT amplicon: 1761 bp. Deletion size: 722 bp. Deletion left flank: TTTTCTCTGCTTCCCTGCGCGTCCTCAAAC. Deletion right flank: CATTCTCAAATAGAAACAGTTTTTTAACCA. Insertion Sequence: CATTTTCGTAGCGTTTTTCTCTTGCTTTACATCCTTTTCCAAACTTGCGATTCTATAAATAAAAAATTTGAATGA."
Proper citation: RRID:WB-STRAIN:WBStrain00036717 Copy
http://www.wormbase.org/db/get?name=WBStrain00036794
Source Database: WormBase (WB)
Affected Genes: WBGene00004750(sea-1)
Genomic Alteration: WBGene00004750(sea-1)
Availability: available
Source References: EMPTY
Synonyms: sea-1(gk799) II.
Alternate IDs: WB-STRAIN:VC1691, CGC_VC1691
Notes: F19B10.9. External left primer: ACCGTCACGAATGAGGTTTC. External right primer: CTCTTGCCGACTTCGTTTTC. Internal left primer: TGCCTGAGCAATTTCCTTCT. Internal right primer: TTATATTTGCGGTGCTGTGC. Internal WT amplicon: 2319 bp. Deletion size: 668 bp. Deletion left flank: AGGAAGAGGACGGCCGGGAGGTGGATTGCA. Deletion right flank: ACGCTAAAATTGTCTGGAAAACTGCCAACG.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036794 Copy
http://www.wormbase.org/db/get?name=WBStrain00036795
Source Database: WormBase (WB)
Affected Genes: WBGene00003626(nhr-32)
Genomic Alteration: WBGene00003626(nhr-32)
Availability: available
Source References: PMID:37906605
Synonyms: nhr-32(gk810) X.
Alternate IDs: WB-STRAIN:VC1692, CGC_VC1692
Notes: K08H2.8. External left primer: AACGAGGCATGTTGGTTTTC. External right primer: CACGAGTGATGCGAGAGTGT. Internal left primer: TTGTTAGGGTGATTGGGAGC. Internal right primer: CGGGTGTTGCTATATTGGGT. Internal WT amplicon: 2237 bp. Deletion size: 697 bp. Deletion left flank: GCGACGCGGCGGACGGGTTTCATTACGGTG. Deletion right flank: AGAATGATAACTCGACCATAAAACGTTTTC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"Supplementary_genotype nhr-32(gk810)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036795 Copy
http://www.wormbase.org/db/get?name=WBStrain00036798
Source Database: WormBase (WB)
Affected Genes: WBGene00001466(gpla-1)
Genomic Alteration: WBGene00001466(gpla-1)
Availability: available
Source References: EMPTY
Synonyms: gpla-1(ok2127) V.
Alternate IDs: WB-STRAIN:VC1695, CGC_VC1695
Notes: F58H1.4. External left primer: TCGCCATAATCATGCAAAAA. External right primer: TTGCACTATTCCAGTGCTCG. Internal left primer: GATGCCCGTATCAACGAGAT. Internal right primer: ATGTGCCAAAGCATAACACG. Internal WT amplicon: 2318 bp. Deletion size: 979 bp. Deletion left flank: AAATTTAAAGGACACTGATCGAAGTTTAGT. Deletion right flank: CAACTTTCCCTCATGGTACTTGTTCGCTAT. Insertion Sequence: TTCCCTCAGGGTACTTGTT. gpla-1 formerly known as flr-2.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036798 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.