Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
WKY-P2rx7em1Tja Resource Report Resource Website |
RRID:RGD_329955459 | Rattus norvegicus | A global P2RX7KO on a WKYbackground was created at Imperial College London using zinc finger nuclease (ZFN) technology to generate a 2 base pair insertion in exon 10 of P2rx7 | 329955459 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 329955459 | 2026-07-25 12:43:12 | 0 | |||||
|
SS-Mmp2em1Mcwi Resource Report Resource Website |
RRID:RGD_4139876 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. | (null) | (null) | 4139876 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 4139876 | 2026-07-25 12:43:12 | 0 | |||
|
SD-Mir500 em1Cgen Resource Report Resource Website |
RRID:RGD_405850241 | Rattus norvegicus | Sprague Dawley rats by microinjection of TALENs in fertilized eggs (Cyagen Biosciences). Briefly, the rno-mir-500 gene (Gene ID: 100314112; MirBase accession no. MIMAT0005321), which was located on rat chromosome X, was selected as the TALEN target site. TALENs were constructed using the Golden Gate Assembly and confirmed by sequencing. The founder, which carried 8- bp deletion (GCACCTGG) in the both strands compared with the wild-type (WT) DNA sequence, were genotyped by PCR followed by DNA-sequencing analysis. After that, heterozygous F1 were produced by mating F0 with WT rats. Heterozygous F1 rats were determined and mated to produce homozygote mutant (mir-500−/−) and WT (mir-500+/+). | 405850241 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405850241 | 2026-07-25 12:43:12 | 0 | |||||
|
LE-Pink1em1Davis Resource Report Resource Website |
RRID:RGD_401827145 | Rattus norvegicus | The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. The rat is deposited at Rat Resource and Research Center (RRRC). Rat Resource and Research Center | 401827145 | mutant | Rat Genome Database (RGD) | RGD | Cryorecovery (as of 2025-01-27) | 401827145 | 2026-07-25 12:43:12 | 0 | |||||
|
WKY-Col4a5em2Matsu Resource Report Resource Website |
RRID:RGD_329845599 | Rattus norvegicus | Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em2 mutant carries a premature stop coden after 15 amino acids due to insertion of a 42bp stop codon. Col4α5 em2 rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. National BioResource Project for the Rat in Japan | 329845599 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 329845599 | 2026-07-25 12:43:12 | 0 | |||||
|
SD-Ahrem1Iexas+/+ Resource Report Resource Website |
RRID:RGD_401940198 | Rattus norvegicus | The Ahr wild type littermates from the cross of heterozygous Ahr rats. The Ahr mutants were created using CRISPR/Cas9 gene editing to delete a portion of exon 2 of Ahr in Sprague Dawley rats . | 401940198 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 401940198 | 2026-07-25 12:43:12 | 0 | |||||
|
WKY-Col4a5em1Matsu Resource Report Resource Website |
RRID:RGD_329845597 | Rattus norvegicus | Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em1 mutant carries a premature stop coden after 9 amino acids due to the insertion of a 20 bp stop codon. Col4a5 KO rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. National BioResource Project for the Rat in Japan | 329845597 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2023-05-30) | 329845597 | 2026-07-25 12:43:12 | 0 | |||||
|
CD-Ctnsem2Vjupk Resource Report Resource Website |
RRID:RGD_155630631 | Rattus norvegicus | The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 2-bp insertion which results in frameshift and pre-mature stop truncated protein. | 155630631 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155630631 | 2026-07-25 12:43:11 | 0 | |||||
|
SD-Esr1em1Bra-/- Resource Report Resource Website |
RRID:RGD_405649860 | Rattus norvegicus | Two target sequences (GCCGTGTTCAACTACCCCGAGGG and GCTGCGCAAGTGTTACGAAGTGG) within the second and third exon, respectively, of the coding sequence of Esr1 (the rat gene encoding ERα) were selected. gRNAs targeting these sequences were synthesized via in vitro transcription. gRNAs (25 ng/ul each) were co- microinjected with Cas9 protein (40 ng/ul) into Sprague-Dawley rat embryos, and embryos were transferred into pseudo-pregnant recipients. Animals heterozygous for a 25 base pair deletion in Esr1 exon 3 were used to establish an ER alpha mutant colony and subsequent homozygous mutant offspring were obtained for study. Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA. | 405649860 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405649860 | 2026-07-25 12:43:12 | 0 | |||||
|
W;WIAR-Izumo1em1Osb Resource Report Resource Website |
RRID:RGD_329845586 | Rattus norvegicus | Izumo1 KO strain was established by CRISPR/Cas9 system using inbred WIAR (RGD:2304222) (SLC, Inc.). sgRNA:GGTGGCTGCAATAAAGACTT, PAM sequence：TGG. A 7-bp deletion（CTTTGGA）after start codon (Met) in exon2 of Izumo1 gene was detected. After establishment of WIAR background KO rats, this strain was mated with Slc:Wistar (RGD:2314928), hence this mutant is in mix background.Izumo1-deficient male rats are infertile. In female rats, no specific phenotype is observed. National BioResource Project for the Rat in Japan | 329845586 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-12-28) | 329845586 | 2026-07-25 12:43:12 | 0 | |||||
|
SD-Ace2em1(ACE2)Prem Resource Report Resource Website |
RRID:RGD_329955557 | Rattus norvegicus | CRISPR/Cas9 knock-in of the human ACE2 transgene into the endogenous locus of the rat Ace2 gene. Single integration of hACE2, with expression driven by the endogenous rat Ace2 promoter. Provides a more natural expression pattern (versus abundant overexpression as seen in prior models). Deposited this strain with the Rat Resource and Research Center: (RRRC), 4011 Discovery Drive, Columbia, MO 65201. Phone: (573) 884-6076 Fax: 573-882-9857 | 329955557 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2023-07-17) | 329955557 | 2026-07-25 12:43:12 | 0 | |||||
|
WKY-Krtcap3em3Mcwi+/+ Resource Report Resource Website |
RRID:RGD_405849411 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Krtcap3 gene of WKY/Ncrlrat embryos. This is the wild type littermate (from heterozygous breeders) carrying wild type Krtcap3. This wild type mutant usually is used as an experimental control. Contact MCW rat distribution at [email protected] | 405849411 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405849411 | 2026-07-25 12:43:12 | 0 | |||||
|
SS-Mmp2em1Mcwi-/- Resource Report Resource Website |
RRID:RGD_5688030 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. | (null) | (null) | 5688030 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 5688030 | 2026-07-25 12:43:12 | 0 | |||
|
SD-Trim44em1Lizh,Tg(Myh6-cre)Lizh Resource Report Resource Website |
RRID:RGD_329969885 | Rattus norvegicus | The conditional Trim44 knockout (Trim44 cKO, SD-Trim44em1Lizh, RGD:329969883) was bred with the α-MHC-Cre tool rat (SD-Tg(Myh6-cre)Lizh, RGD:329969882) to generate cardiac-specific Trim44 knockout which had the Trim44flox/flox/α-MHC-Cre genotype. | 329969885 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 329969885 | 2026-07-25 12:43:12 | 0 | |||||
|
WI-Nanos3em1(tdTomato)Nips Resource Report Resource Website |
RRID:RGD_401795481 | Rattus norvegicus | The targeting vector was designed to replace the stop codon of Nanos3 with T2A-2xtdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The pups were judged correct gene-targeting by genomic PCR. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. The tdTomato fluorescence faithfully label Nanos3 expressing cells. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan. | 401795481 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-11) | 401795481 | 2026-07-25 12:43:12 | 0 | |||||
|
F344-Hspa8m1Kyo Resource Report Resource Website |
RRID:RGD_598092575 | Rattus norvegicus | This strain, called KK rats, in homozygous rats show gait abnormalities from around 5-6 weeks of age. Thereafter, the neurological symptoms progress rapidly, leading to emaciation and death. The mutant gene was named kk, as Kenta Kumafuji was the discoverer of the gait abnormality. National BioResource Project for the Rat in Japan | 598092575 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2025-03-27) | 598092575 | 2026-07-25 12:43:13 | 0 | |||||
|
SD-Lgals3em1Dfult Resource Report Resource Website |
RRID:RGD_598092509 | Rattus norvegicus | Gal-3 KO rats were developed using CRISPR technology on the Sprague-Dawley background (Sage). CRISPR guides were selected targeting the fifth exon, and gene disruption was confirmed by genomic sequencing and immunoblot analysis for Gal-3 protein expression in lung tissue. PMCID: PMC6589585 Availability Contact Email: [email protected] at Augusta University | 598092509 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2025-03-21) | 598092509 | 2026-07-25 12:43:13 | 0 | |||||
|
LE-Sstem1(cre)Bfdi Resource Report Resource Website |
RRID:RGD_598092583 | Rattus norvegicus | Cre was inserted at the start codon (methionine) of the somatostatin (Sst) gene. The Sst precursor is then expressed using the T2A peptide as a linker. Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). National BioResource Project for the Rat in Japan | 598092583 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092583 | 2026-07-25 12:43:13 | 0 | |||||
|
SD.LIS-Actbtm1(CAG-GCaMP8)Ksak Resource Report Resource Website |
RRID:RGD_598092585 | Rattus norvegicus | The ES cell line derived from Lister Hooded rats (Seac:LIS), which was established by Prof. Sakimura at Department of Animal Model Development, Brain Research Institute, Niigata University, was used. Cloned ES cells established by introducing a vector of G8CaMP-flox stop at the 3'non-coding site of the Actb gene were injected into fertilized eggs of SD rats (Slc:SD) using a microinjection method. National BioResource Project for the Rat in Japan | 598092585 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092585 | 2026-07-25 12:43:13 | 0 | |||||
|
LE-Calcaem4(cre)Daiyi Resource Report Resource Website |
RRID:RGD_598092582 | Rattus norvegicus | Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). Cre and T2A were inserted into the start codon (methionine) of the second exon of the Calca gene using CRISPR/Cas9. National BioResource Project for the Rat in Japan | 598092582 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092582 | 2026-07-25 12:43:13 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
