Organisms   Select Another Resource Report Type

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=151664748

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 151664748
Notes: CRISPR/Cas9 system was used to generate this mutant. Guide RNA sequence is the following: 5'-CGGCTGTGTAACCCTGATGA-3'. Cas9-mediated cleavage at exon 7 in the Slc9a6 locus resulted in the insertion of 2 bp (TT) generating frameshift and a premature stop codon.

Proper citation: RRID:RGD_151664748 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126777684

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 126777684
Notes: The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out rat strain with 14- bp deletion causing frameshift mutation in the gene.

Proper citation: RRID:RGD_126777684 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126790464

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 126790464
Notes: The CRISPR/Cas9 genome editing system was injected into fertilized Sprague-Dawley rat embryos and inserted into a surrogate. Two genomic RNAs (gRNAs) were designed to target the 5ʹ-end of the Ube3a gene (upstream of the Ube3a coding sequence) and two gRNAs target sequences downstream of Ube3a. gRNA pairs were used on each end of the deletion to maximize the probability of a complete deletion of the 90-kb region encompassing the Ube3a gene. The 90 kb deletion in Ube3a was confirmed by genome sequencing. Only pups with maternal inheritance of the deletion carried traits for model of Angleman Syndrome.

Proper citation: RRID:RGD_126790464 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150521599

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 150521599
Notes: CRISPR/Cas9 system targeting exon 10 of the rat Tshr gene was injected into Sprague Dawley embryos to create this mutant strain. The strain was homozygous with 5 bp deletion (CACGC) which introduces frameshift at residue 449 and a stop codon at 478 (P449fsX478).

Proper citation: RRID:RGD_150521599 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150573818

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 150573818
Notes: A pair of TALENs targeting coding region of rat Nkx3-1gene was electroporated into SD zygotes to create NKx3-1 mutants. The resulting mutation was indel mutation with sequences loss beyond TALEN recognition resulting a premature termination codon of the protein.

Proper citation: RRID:RGD_150573818 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127345123

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 127345123
Notes: This line #1 Angptl8 knock out (KO) rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3' (sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_127345123 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127345124

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 127345124
Notes: This line #1 Angptl8 heterozygous rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3'(sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_127345124 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429815

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 150429815
Notes: The homozygous wild type Gnal rats were littermates of SD-Gnalem1Hpng+/- (RGD:150429814) created by CRISPR/Cas9. The heterozygous mutants carried one copy of mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of theGnal splicing variant 2 was detected resulting in an early stop at position150 and producing a truncated protein with 50 amino acids .

Proper citation: RRID:RGD_150429815 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676463

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-09-18)
References:
Synonyms:
Alternate IDs: 38676463
Notes: HHSE/Hat was derived from Hirosaki hairless rat (HHR) and Hirosaki small-eye rat (HiSER), which are Sprague-Dawley rat (SDR)mutant lines. HHR was established in 1984 as a spontaneous mutant of SDR that has been inbred in Department of Biochemistry and Genome Biology Hirosaki University Graduate School of Medicine. Whole body shows hypotrichosis, abnormal differentiation of thymus, and regressed mammary gland in females. These mutations are autosomal recessive and are suggested to be due to deletion of the keratin gene cluster and the lectin-like receptor gene Ly49s3. HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat maintained in our course in the same way as HHR/Hat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. National BioResource Project for the Rat in Japan ;Depart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of Medicine

Proper citation: RRID:RGD_38676463 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676464

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-09-18)
References:
Synonyms:
Alternate IDs: 38676464
Notes: By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 7 bp deletion on Exon1. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_38676464 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150523757

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 150523757
Notes: Microinjection of Sprague-Dawley rat zygotes with ZFN mRNA specific for the JH locus resulted in the generation of a mutant animal with a 2465 bp DNA deletion, spanning the entire locus

Proper citation: RRID:RGD_150523757 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=27095885

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 27095885
Notes: This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS.BN(D13Hmgc41-D13Rat101)/Mcwi rat embryos. The resulting mutation is a net 4-bp frameshift deletion in exon 5. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_27095885 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=149735334

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 149735334
Notes: Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1^em1 ( Wfs1-ex5-KO232), Wfs1^em2 (Wfs1-ex5-KO266) and Wfs1^em3 (Wfs1-ex5-INS244). Wfs1^em1 rats carry a 184 bp deletion, resulting 27 amino acids deletion in exon 5 (aa212-238) and a new GCC codon(alanine).

Proper citation: RRID:RGD_149735334 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150521602

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 150521602
Notes: This Iffa Credo ( IC) hairless strain was a spontaneous recessive mutant identified in a colony of Crl:OFA(SD) at 1974. A large intracellular out-of-frame deletion in Dsg4 of IC mutant rats was identified. The intragenic deletion spanning exons 2?10 that results in a significant down-regulation of Dsg4 message.

Proper citation: RRID:RGD_150521602 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=40924656

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown (as of 2021-01-19)
References:
Synonyms:
Alternate IDs: 40924656
Notes: Established as congenics by introducing fa from 13M/Vc to BN/Crl

Proper citation: RRID:RGD_40924656 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=151356945

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 151356945
Notes: Two DNA expression constructs, the bacterial tetracyclin repressor (TetR) under the expression control of human EF1a promoter and the improved Cre recombinase (iCre) under Fos promoter were joined in an antiparallel orientation in one rat ROSA26 targeting cassette. The DNA construct, together with CRISPR /Cas9 system, was injected to one cell Long-Evans (Crl:LE) rat embryos and founders were identified and bred for 8 generations at at NIDA IRP (Hope lab).

Proper citation: RRID:RGD_151356945 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152999002

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 152999002
Notes: Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system This strain has been deposited with RRRC Rat Resource and Research Center

Proper citation: RRID:RGD_152999002 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152999000

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 152999000
Notes: Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system This strain has been deposited with RRRC

Proper citation: RRID:RGD_152999000 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127284870

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 127284870
Notes: This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppc^em3Kyo strain ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1) National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_127284870 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150521559

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 150521559
Notes: Male SD rats were treated with the mutagen N-ethyl-N-nitrosourea (60 mg/kg intraperitoneally) at ages 9 and 10 weeks. A heterozygous mutant founder carrying a T to C transition that encoded a substitution of a proline residue (CCA) for a highly conserved serine residue (TCA) at amino acid position 94 was identified. This mutant male was mated to a LEW female and phenotyping by the expression of CD8a and CD8ab.

Proper citation: RRID:RGD_150521559 Copy   

•   Source: Integrated Animals