Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126848804
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 126848804
Notes: The Sleeping Beauty transposon system was used to insert the sleeping beauty transposon into the first intron of the rat Trpc4 gene. Trpc4 knock-out (510 bp) and wild-type allele (905 bp) were confirmed using PCR and gel electrophoresis
Proper citation: RRID:RGD_126848804 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676255
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-09-16)
References:
Synonyms:
Alternate IDs: 38676255
Notes: TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 18-bp deletion in the exon4 of Hcn1 gene. It is predicted that 6 amino-acid deleted HCN1 protein is expressed. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_38676255 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150521708
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 150521708
Notes: The Sleeping Beauty transposon-mediated mutagenesis was used to knock out the rat Tbc1d1 gene in in rat spermatogonial stem cells from Sprague Dawley.
Proper citation: RRID:RGD_150521708 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676250
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-09-16)
References:
Synonyms:
Alternate IDs: 38676250
Notes: TALEN (Left:ttcagAATGATTCATGGG, Right:ACGCACTCTTCAAAGCTA)targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 13-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_38676250 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14402421
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 14402421
Notes: The Zinc Finger Nuclease system was used to knock-in SNP rs16969968 in exon 5 (D398N) thus created a missense mutation. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). Heterozygous rats are currently bred to generate heterozygous and homozygous.
Proper citation: RRID:RGD_14402421 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329322880
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2023-04-24)
References:
Synonyms:
Alternate IDs: 329322880
Notes: The gRNA to rat Mertk gene, and Cas9 mRNA were co-injected into fertilized rat eggs to generate targeted knockout offspring. F0 founder animals were identified by PCR followed by sequence analysis, which were bred to wildtype rat to test germline transmission and F1 animal generation. This strain was derived from founder 6# carrying a 13934 deletion which included exons 3 to 5. Cyagen Biosciences (Guangzhou) Inc.Building D, 3rd Floor, 3 Juquan Road, Science City, Guangzhou, 510663, China
Proper citation: RRID:RGD_329322880 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155900757
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-02-09)
References:
Synonyms:
Alternate IDs: 155900757
Notes: Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous CC nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. The laboratory has deposited these strains with the RRRC.
Proper citation: RRID:RGD_155900757 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155900755
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-02-09)
References:
Synonyms:
Alternate IDs: 155900755
Notes: Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous GG nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. The laboratory has deposited these strains with the RRRC.
Proper citation: RRID:RGD_155900755 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=158013766
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 158013766
Notes: This Akt mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT;
nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein.
Proper citation: RRID:RGD_158013766 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631259
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155631259
Notes: These mutants were found in Sprague-Dawley rats at University of Puebla in 1989. A spontaneous neurological mutation was detected in a colony of Sprague Dawley rats. The animals developed a progressive neurological syndrome characterized by tremor (which appeared at the age of 1 month), ataxia (at 4 months), immobility episodes (after 5-6 months), audiogenic seizures and hindlimb paralysis (after 10 months). Cross breeding experiments indicate that this is an autosomal recessive mutation, The rat line was named taiep (tremor, ataxia, tonic immobility episodes, epilepsy and paralysis) rats.
Proper citation: RRID:RGD_155631259 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631293
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155631293
Notes: The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 9-bp deletion within the conserved 15-bp regulatory region that leads to the loss of 3 amino acids (aa 441-443 analogous to human PDE3A aa 444-446).
Proper citation: RRID:RGD_155631293 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631295
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155631295
Notes: The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 20-bp deletion within the conserved 15-bp regulatory region that leads to n a frameshift and thus in a truncated and functionally deleted protein (functional DEL).
Proper citation: RRID:RGD_155631295 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=288084582
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 288084582
Notes: This CRISPR/Cas9 induced mutation Phe54Leu is induced in embryos of F344/NSlc. The genome editing system targeting exon 3 of Txn1 gene ( (c. 160 T > C) was delivered into embryos by electroporation. The two-cell stage embryos were transferred into the oviducts of pseudopregnant females. The rat called Txn1-F54L rat, replicates Adem rats (RGD:288084580) which carried Phe54Leu mutation in the same gene.These two strains exhibit similar phenotype.
Proper citation: RRID:RGD_288084582 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=151665772
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2022-04-01)
References:
Synonyms:
Alternate IDs: 151665772
Notes: The targeting vector was designed to replace the stop codon of Tfap2c with T2A-tdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The pups were judged correct gene-targeting by genomic PCR. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. The tdTomato fluorescence faithfully label Tfap2c expressing cells. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan.
Proper citation: RRID:RGD_151665772 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13800848
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 13800848
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 1 in the Nlrp3 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13800848 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25394532
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 25394532
Notes: The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The result is a 6-bp deletion in exon 5 of the gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_25394532 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631261
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155631261
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9 targeting exon 4 of rat Brca1was injected to fertilized eggs of Jcl:SD rats (Clea Japan). The founder animal carried c.188T>A (p.L63X) was mated to closed-colony Jcl:SD rats.
Proper citation: RRID:RGD_155631261 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629459
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 629459
Notes: Obtained from Louisiana Sate University Medical Center, New Orleans by the Department of Physiology.
Proper citation: RRID:RGD_629459 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629462
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 629462
Notes: This recessive fatty Zucker rat carries a mutation that occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size.
Proper citation: RRID:RGD_629462 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054420
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 10054420
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Mprl28 gene of LEW/NCrl rat embryos. The resulting mutation is a 7-bp insertion in the 2-bp deletion site in the Mrpl28 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054420 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.