Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Slc9a6 em1Moro Resource Report Resource Website |
RRID:RGD_151664748 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant. Guide RNA sequence is the following: 5'-CGGCTGTGTAACCCTGATGA-3'. Cas9-mediated cleavage at exon 7 in the Slc9a6 locus resulted in the insertion of 2 bp (TT) generating frameshift and a premature stop codon. | 151664748 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 151664748 | 2026-07-25 12:43:10 | 0 | |||||
|
W-Mkxem1Asah Resource Report Resource Website |
RRID:RGD_126777684 | Rattus norvegicus | The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out rat strain with 14- bp deletion causing frameshift mutation in the gene. | 126777684 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126777684 | 2026-07-25 12:43:09 | 0 | |||||
|
SD-Ube3aem1Jue Resource Report Resource Website |
RRID:RGD_126790464 | Rattus norvegicus | The CRISPR/Cas9 genome editing system was injected into fertilized Sprague-Dawley rat embryos and inserted into a surrogate. Two genomic RNAs (gRNAs) were designed to target the 5ʹ-end of the Ube3a gene (upstream of the Ube3a coding sequence) and two gRNAs target sequences downstream of Ube3a. gRNA pairs were used on each end of the deletion to maximize the probability of a complete deletion of the 90-kb region encompassing the Ube3a gene. The 90 kb deletion in Ube3a was confirmed by genome sequencing. Only pups with maternal inheritance of the deletion carried traits for model of Angleman Syndrome. | 126790464 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126790464 | 2026-07-25 12:43:09 | 0 | |||||
|
SD-Tshrem1Mlit Resource Report Resource Website |
RRID:RGD_150521599 | Rattus norvegicus | CRISPR/Cas9 system targeting exon 10 of the rat Tshr gene was injected into Sprague Dawley embryos to create this mutant strain. The strain was homozygous with 5 bp deletion (CACGC) which introduces frameshift at residue 449 and a stop codon at 478 (P449fsX478). | 150521599 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150521599 | 2026-07-25 12:43:10 | 0 | |||||
|
SD-Nkx3-1em1Pjhak-/- Resource Report Resource Website |
RRID:RGD_150573818 | Rattus norvegicus | A pair of TALENs targeting coding region of rat Nkx3-1gene was electroporated into SD zygotes to create NKx3-1 mutants. The resulting mutation was indel mutation with sequences loss beyond TALEN recognition resulting a premature termination codon of the protein. | 150573818 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150573818 | 2026-07-25 12:43:10 | 0 | |||||
|
F344-Angptl8em1Kyo-/- Resource Report Resource Website |
RRID:RGD_127345123 | Rattus norvegicus | This line #1 Angptl8 knock out (KO) rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3' (sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1. National BioResource Project for the Rat in Japan | 127345123 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 127345123 | 2026-07-25 12:43:09 | 0 | |||||
|
F344-Angptl8em1Kyo+/- Resource Report Resource Website |
RRID:RGD_127345124 | Rattus norvegicus | This line #1 Angptl8 heterozygous rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3'(sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1. National BioResource Project for the Rat in Japan | 127345124 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 127345124 | 2026-07-25 12:43:09 | 0 | |||||
|
SD-Gnalem1Hpng+/+ Resource Report Resource Website |
RRID:RGD_150429815 | Rattus norvegicus | The homozygous wild type Gnal rats were littermates of SD-Gnalem1Hpng+/- (RGD:150429814) created by CRISPR/Cas9. The heterozygous mutants carried one copy of mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of theGnal splicing variant 2 was detected resulting in an early stop at position150 and producing a truncated protein with 50 amino acids . | 150429815 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150429815 | 2026-07-25 12:43:10 | 0 | |||||
|
HHSE/Hat Resource Report Resource Website |
RRID:RGD_38676463 | Rattus norvegicus | HHSE/Hat was derived from Hirosaki hairless rat (HHR) and Hirosaki small-eye rat (HiSER), which are Sprague-Dawley rat (SDR)mutant lines. HHR was established in 1984 as a spontaneous mutant of SDR that has been inbred in Department of Biochemistry and Genome Biology Hirosaki University Graduate School of Medicine. Whole body shows hypotrichosis, abnormal differentiation of thymus, and regressed mammary gland in females. These mutations are autosomal recessive and are suggested to be due to deletion of the keratin gene cluster and the lectin-like receptor gene Ly49s3. HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat maintained in our course in the same way as HHR/Hat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. National BioResource Project for the Rat in Japan ;Depart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of Medicine | 38676463 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-09-18) | 38676463 | 2026-07-25 12:43:10 | 0 | |||||
|
WIC-Cspg4em1Kyst Resource Report Resource Website |
RRID:RGD_38676464 | Rattus norvegicus | By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 7 bp deletion on Exon1. National BioResource Project for the Rat in Japan | 38676464 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-18) | 38676464 | 2026-07-25 12:43:10 | 0 | |||||
|
SD-Ighmem2Ang Resource Report Resource Website |
RRID:RGD_150523757 | Rattus norvegicus | Microinjection of Sprague-Dawley rat zygotes with ZFN mRNA specific for the JH locus resulted in the generation of a mutant animal with a 2465 bp DNA deletion, spanning the entire locus | 150523757 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150523757 | 2026-07-25 12:43:10 | 0 | |||||
|
SS.BN-(D13Hmgc41-D13Rat101)-Renem2Mcwi Resource Report Resource Website |
RRID:RGD_27095885 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS.BN(D13Hmgc41-D13Rat101)/Mcwi rat embryos. The resulting mutation is a net 4-bp frameshift deletion in exon 5. Contact MCW rat distribution at [email protected] | 27095885 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 27095885 | 2026-07-25 12:43:10 | 0 | |||||
|
SD-Wfs1em1Ptsn Resource Report Resource Website |
RRID:RGD_149735334 | Rattus norvegicus | Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1em1 ( Wfs1-ex5-KO232), Wfs1em2 (Wfs1-ex5-KO266) and Wfs1em3 (Wfs1-ex5-INS244). Wfs1em1 rats carry a 184 bp deletion, resulting 27 amino acids deletion in exon 5 (aa212-238) and a new GCC codon(alanine). | 149735334 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 149735334 | 2026-07-25 12:43:09 | 0 | |||||
|
OFA(SD)-Dsg4hr/Crl Resource Report Resource Website |
RRID:RGD_150521602 | Rattus norvegicus | This Iffa Credo ( IC) hairless strain was a spontaneous recessive mutant identified in a colony of Crl:OFA(SD) at 1974. A large intracellular out-of-frame deletion in Dsg4 of IC mutant rats was identified. The intragenic deletion spanning exons 2?10 that results in a significant down-regulation of Dsg4 message. | 150521602 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150521602 | 2026-07-25 12:43:10 | 0 | |||||
|
BN.ZUC-Leprfa Resource Report Resource Website |
RRID:RGD_40924656 | Rattus norvegicus | Established as congenics by introducing fa from 13M/Vc to BN/Crl | 40924656 | mutant | Rat Genome Database (RGD) | RGD | Unknown (as of 2021-01-19) | 40924656 | 2026-07-25 12:43:09 | 0 | |||||
|
LE-ROSA26em1(EF1a-TetR, Fos-iCre)/Bhope Resource Report Resource Website |
RRID:RGD_151356945 | Rattus norvegicus | Two DNA expression constructs, the bacterial tetracyclin repressor (TetR) under the expression control of human EF1a promoter and the improved Cre recombinase (iCre) under Fos promoter were joined in an antiparallel orientation in one rat ROSA26 targeting cassette. The DNA construct, together with CRISPR /Cas9 system, was injected to one cell Long-Evans (Crl:LE) rat embryos and founders were identified and bred for 8 generations at at NIDA IRP (Hope lab). | 151356945 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 151356945 | 2026-07-25 12:43:10 | 0 | |||||
|
LE-Fxn em2Fara-/+/Rrrc Resource Report Resource Website |
RRID:RGD_152999002 | Rattus norvegicus | Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system This strain has been deposited with RRRC Rat Resource and Research Center | 152999002 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 152999002 | 2026-07-25 12:43:10 | 0 | |||||
|
LE-Fxn em2Fara-/+ Resource Report Resource Website |
RRID:RGD_152999000 | Rattus norvegicus | Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system This strain has been deposited with RRRC | 152999000 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 152999000 | 2026-07-25 12:43:10 | 0 | |||||
|
F344-Nppcem3Kyo Resource Report Resource Website |
RRID:RGD_127284870 | Rattus norvegicus | This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem3Kyo strain ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1) National BioResource Project for the Rat in Japan | 127284870 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 127284870 | 2026-07-25 12:43:09 | 0 | |||||
|
LEW.SD-CD8am1Trg Resource Report Resource Website |
RRID:RGD_150521559 | Rattus norvegicus | Male SD rats were treated with the mutagen N-ethyl-N-nitrosourea (60 mg/kg intraperitoneally) at ages 9 and 10 weeks. A heterozygous mutant founder carrying a T to C transition that encoded a substitution of a proline residue (CCA) for a highly conserved serine residue (TCA) at amino acid position 94 was identified. This mutant male was mated to a LEW female and phenotyping by the expression of CD8a and CD8ab. | 150521559 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150521559 | 2026-07-25 12:43:10 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
