Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Myh7bem1Blar+/+ Resource Report Resource Website |
RRID:RGD_149735898 | Rattus norvegicus | This is the homozygous wild type littermate from crossing of heterozygous SD-Myh7b mutants. The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death. | 149735898 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 149735898 | 2026-07-25 12:43:08 | 0 | |||||
|
SS-Xdhem2Mcwi Resource Report Resource Website |
RRID:RGD_14398481 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. Contact MCW rat distribution at [email protected] | 14398481 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 14398481 | 2026-07-25 12:43:09 | 0 | |||||
|
LEW-Glp1rem3Mcwi Resource Report Resource Website |
RRID:RGD_14394491 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at [email protected] | 14394491 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2026-02-19) | 14394491 | 2026-07-25 12:43:08 | 0 | |||||
|
LE-Scn2aem1Mcwi Resource Report Resource Website 1+ mentions |
RRID:RGD_25394530 | Rattus norvegicus | The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTTGGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT). Autism Rat Model Resource. Contact MCW rat distribution at [email protected] | 25394530 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-02-20) | 25394530 | 2026-07-25 12:43:08 | 1 | |||||
|
SD-Cyp3a23/3a1em1Myliu,Cyp3a2em1Myliu Resource Report Resource Website |
RRID:RGD_14696722 | Rattus norvegicus | This rat strain is a double knock out for Cyp3a23/3a1 and Cyp3a2 created by using CRISPR/Cas9 targeting exons of Cyp3a23/3a1 and Cyp3a2. This strain carries a 22-bp deletion of Cyp3a23/3a1 and a 10-bp deletion of Cyp3a2 on Sprague Dawley background. | 14696722 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14696722 | 2026-07-25 12:43:08 | 0 | |||||
|
W-Trpa1em1Kcrd Resource Report Resource Website |
RRID:RGD_38676448 | Rattus norvegicus | This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted. National BioResource Project for the Rat in Japan | 38676448 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2020-09-17) | 38676448 | 2026-07-25 12:43:08 | 0 | |||||
|
SD-Ubdem1 Resource Report Resource Website 1+ mentions |
RRID:RGD_126925138 | Rattus norvegicus | This Ubd (FAT10) knockout rat strain was generated using theCRISPR-Cas9 technique in a Sprague Dawley (SD) background. The knockout allele has a 911 bp deletion of exon 2, leading to a truncated protein of Ubd. | 126925138 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925138 | 2026-07-25 12:43:09 | 1 | |||||
|
LE-Dyrk1aem1Mcwi Resource Report Resource Website |
RRID:RGD_40818253 | Rattus norvegicus | The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 14-bp deletion in exon 3 Contact MCW rat distribution at [email protected] | 40818253 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 40818253 | 2026-07-25 12:43:09 | 0 | |||||
|
DA.F344-Dpp4DPPIV/SvH Resource Report Resource Website |
RRID:RGD_41408337 | Rattus norvegicus | Generation of the congenic strain was started with an initial cross between F344/Crl(Wiga)SvH-Dpp4m females, homozygous for the loss-of-function mutation in the Dpp4 gene on RNO3 and a DA/Ztm wild type male rat. The DP4 deficient congenic DA strain is maintained via brother=sister mating | 41408337 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41408337 | 2026-07-25 12:43:09 | 0 | |||||
|
W-Phf24em11Iexas Resource Report Resource Website |
RRID:RGD_38676451 | Rattus norvegicus | This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 11 and has a 128-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. National BioResource Project for the Rat in Japan | 38676451 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-17) | 38676451 | 2026-07-25 12:43:09 | 0 | |||||
|
SS-Prr5em2Mcwi Resource Report Resource Website |
RRID:RGD_14398465 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene. Contact MCW rat distribution at [email protected] | 14398465 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2019-04-19) | 14398465 | 2026-07-25 12:43:08 | 0 | |||||
|
SD-Myh7bem1Blar+/- Resource Report Resource Website |
RRID:RGD_126925949 | Rattus norvegicus | The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death. | 126925949 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925949 | 2026-07-25 12:43:09 | 0 | |||||
|
WI;WDB-Prdm14tm1(H2BVenus)Nips Resource Report Resource Website |
RRID:RGD_125097491 | Rattus norvegicus | Targeting vector was designed to replace 1st and 4th exons encoding DNA-binding domain of Prdm14 locus with H2BVenus. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation . Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. Homozygous Prdm14 knocked-in rats have the germ cell-deficient phenotype. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki, Aichi 444-8787, JAPAN | 125097491 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo (as of 2021-04-01) | 125097491 | 2026-07-25 12:43:09 | 0 | |||||
|
WI-Sall1em1Nips Resource Report Resource Website |
RRID:RGD_125097492 | Rattus norvegicus | Sall1 mutation was induced by injecting a mix of two pX330 expressing Cas9 and sgRNA targeting the sequence into Crlj:WI rat embryos. The resulting mutation is a 4456-bp deletion in exon 2 to 3. Homozygous Sall1 knocked-out rats had the anephric phenotype at E21.5, and died at postnatal Day-1. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki, Aichi 444-8787, JAPAN. | 125097492 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo (as of 2021-04-01) | 125097492 | 2026-07-25 12:43:09 | 0 | |||||
|
F344-Rag2em1Iexas Resource Report Resource Website |
RRID:RGD_38599189 | Rattus norvegicus | This strain was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This strain shows severe combined immunodeficiency (SCID) caused by 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. National BioResource Project for the Rat in Japan | 38599189 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2020-09-14) | 38599189 | 2026-07-25 12:43:09 | 0 | |||||
|
WI;WDB-Sall1tm4(tdTomato)Nips Resource Report Resource Website |
RRID:RGD_125097494 | Rattus norvegicus | Targeting vector was designed to replace 2nd and 3rd exons encoding DNA-binding domain of Sall1 locus with tdTomato. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation.Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats..These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. Homozygous Sall1 knocked-in rats had the anephric phenotype at E21.5, and died at postnatal Day-1. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, JAPAN | 125097494 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo (as of 2021-04-01) | 125097494 | 2026-07-25 12:43:09 | 0 | |||||
|
WIC;WI;WDB-Kiss1tm8Nips Resource Report Resource Website |
RRID:RGD_125097497 | Rattus norvegicus | This strain was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem (ES) cells with a targeting vector. A targeting vector was designed to insert two loxP sites encompassing exons 2 and 3 of the Kiss1 gene coding for 52-amino acid rat kisspeptin-1 (Kiss1) and a neomycin-resistance gene into the Kiss1 locus in rat ES cells via homologous recombination. Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Iar:Wistar-Imamichi rats to produce heterozygous founder rats. This rat strain is being maintained by crossing the founder rat with Iar:Wistar-Imamichi rats. | 125097497 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo (as of 2021-04-01) | 125097497 | 2026-07-25 12:43:08 | 0 | |||||
|
WI-Grm2em1 Resource Report Resource Website |
RRID:RGD_41410881 | Rattus norvegicus | This mutant rat strain was produced by Transposagen Biopharmaceutical and available in mGluR2+/- breeding pairs. The genome modification created a premature stop codon insertion that causes a nonsense mutation at amino acid C407, deleting the transmembrane and intracellular domains of the receptor and rendering the gene nonfunctional. | 41410881 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41410881 | 2026-07-25 12:43:08 | 0 | |||||
|
WIC-Cspg4em3Kyst Resource Report Resource Website |
RRID:RGD_39128163 | Rattus norvegicus | By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 2 bp insertion on Exon1. National BioResource Project for the Rat in Japan | 39128163 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-23) | 39128163 | 2026-07-25 12:43:09 | 0 | |||||
|
SS-Vwfem2Mcwi-/- Resource Report Resource Website |
RRID:RGD_18182944 | Rattus norvegicus | CRISPR/Cas9 mediated gene editing was used to delete a 130,954bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos Contact MCW rat distribution at [email protected] | 18182944 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2020-01-14) | 18182944 | 2026-07-25 12:43:08 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
