Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SS-Ptk2bem3Mcwi Resource Report Resource Website |
RRID:RGD_13792811 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a7-bp deletion in exon 2. | 13792811 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13792811 | 2026-07-25 12:43:05 | 0 | |||||
|
SD-Nr1i3em1Sage Resource Report Resource Website |
RRID:RGD_12903267 | Rattus norvegicus | This model contains a ZFN-induced 10-bp deletion within rat Nr1i3 gene. Horizon Discovery | 12903267 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-05-10) | 12903267 | 2026-07-25 12:43:05 | 0 | |||||
|
SS-Kcnj1em1Kasu-/- Resource Report Resource Website |
RRID:RGD_13782353 | Rattus norvegicus | Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single-cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes. | 13782353 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13782353 | 2026-07-25 12:43:05 | 0 | |||||
|
SS-Kcnj1em1Kasu+/- Resource Report Resource Website |
RRID:RGD_13782351 | Rattus norvegicus | Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is TCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single -cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes. | 13782351 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13782351 | 2026-07-25 12:43:05 | 0 | |||||
|
SD-Nfe2l2em1Mcwi+/- Resource Report Resource Website |
RRID:RGD_13208519 | Rattus norvegicus | This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. | 13208519 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-08-09) | 13208519 | 2026-07-25 12:43:04 | 0 | |||||
|
SD-Nfe2l2em1Mcwi-/- Resource Report Resource Website |
RRID:RGD_13208518 | Rattus norvegicus | This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. | 13208518 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-08-09) | 13208518 | 2026-07-25 12:43:04 | 0 | |||||
|
SD-Nfe2l2em1Mcwi+/+ Resource Report Resource Website |
RRID:RGD_13208517 | Rattus norvegicus | This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. | 13208517 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-08-09) | 13208517 | 2026-07-25 12:43:04 | 0 | |||||
|
SS-Avpr2em4Mcwi Resource Report Resource Website |
RRID:RGD_13793376 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2. Contact MCW rat distribution at [email protected] | 13793376 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2018-10-03) | 13793376 | 2026-07-25 12:43:05 | 0 | |||||
|
W;Cg-Acrtm1Osb Resource Report Resource Website |
RRID:RGD_13503336 | Rattus norvegicus | , Acr {tm1 Osb} | After homologous recombination using ES cells derived from hybrid (mix) breed of Slc:Wistar (female) and F344/NSlc (male), Acr KO strain was established by GLT at Osaka University. The genomic region including exon 1 to exon 3 is replaced by Neo resistance gene. After mating with Slc:Wistar, this strain is maintained by sib mating or with Slc:Wistar rats. National BioResource Project for the Rat in Japan | 13503336 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-01-12) | 13503336 | 2026-07-25 12:43:05 | 0 | ||||
|
W-Myo7atnd/Hubr Resource Report Resource Website |
RRID:RGD_13204704 | Rattus norvegicus | Male Wistar founder rats were mutagenized using ENU and mated with untreated female to establish F1 population. Selected F1 progeny were mated to produce F2 and then to breed induced mutation to homozygosity. | 13204704 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13204704 | 2026-07-25 12:43:04 | 0 | |||||
|
LEW.1WR1-Ifnar1em2 Resource Report Resource Website 1+ mentions |
RRID:RGD_12910494 | Rattus norvegicus | The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion and 4-bp insertion in exon 4 of Ifnar1 gene. | 12910494 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12910494 | 2026-07-25 12:43:04 | 1 | |||||
|
LEW.1WR1-Ifnar1em1 Resource Report Resource Website 1+ mentions |
RRID:RGD_12910493 | Rattus norvegicus | The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion in exon 4 of Ifnar1 gene. | 12910493 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12910493 | 2026-07-25 12:43:04 | 1 | |||||
|
WI-Slc6a4m1Hubr-/- Resource Report Resource Website |
RRID:RGD_14390067 | Rattus norvegicus | The Slc6a4 knockout rat was generated by target-selected ENU-induced mutagenesis. An ENU-induced premature stop codon in exon 3 of the Slc6a4 gene in a female rat (Wistar from Crl) was identified.The homozygoous mutant rats were generated by incrossed between heterozygous Slc6a4 knock out rats. | 14390067 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14390067 | 2026-07-25 12:43:06 | 0 | |||||
|
LEW-Nek8lpk/Arc Resource Report Resource Website |
RRID:RGD_42721974 | Rattus norvegicus | The Lewis Polycystic Kidney (LPK) rat is a spontaneous mutant identified in the LEW colony (LEW/SsNArc) maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The causal gene is identified as a non-synonymous mutation R650C in the NIMA (never in mitosis gene a)- related kinase 8 ( Nek8) gene. | 42721974 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 42721974 | 2026-07-25 12:43:06 | 0 | |||||
|
SD-Pde6bem1Baek Resource Report Resource Website |
RRID:RGD_42721977 | Rattus norvegicus | Cpf1 mRNA (50 ng per uL) and CRISPR RNA (100 ng per uL) were co-microinjected into the cytoplasm of pronuclear stage embryos; surviving embryos were transplanted into the oviducts of pseudo-pregnant surrogate mothers to generate live animals. A Pde6b-mutant rat line with an 11-bp deletion in exon 1 was established. Western blot analysis confirmed deficiency of Pde6b protein in the homozygous mutant retina, indicating successful generation of Pde6b-deficient rats with Cpf1-mediated gene targeting. | 42721977 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 42721977 | 2026-07-25 12:43:06 | 0 | |||||
|
WI-Lpin1m1Hubr Resource Report Resource Website |
RRID:RGD_38599152 | Rattus norvegicus | The mutant rats were created using N-ethyl-N-nitrosourea (ENU) mutagenesis. A point mutation in the 5'-end splice site of intron 18 resulting in mis-splicing, a reading frameshift, and a premature stop codon was identified. As this mutation does not induce nonsense-mediated decay, it allows the production of a truncated Lipin 1 protein lacking phosphatidate phosphatase 1 activity. | 38599152 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38599152 | 2026-07-25 12:43:06 | 0 | |||||
|
SD-Il1rl2tm1(Myh6-cre)Mhzh Resource Report Resource Website |
RRID:RGD_126925135 | Rattus norvegicus | This line was produced by mating rats carrying IIl1rl2f/f allele and Myh6-cre-allele. The expression of Il1rl2 was knockout in cardiomyocytes. | 126925135 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925135 | 2026-07-25 12:43:06 | 0 | |||||
|
SD-Mstnem1Cqin Resource Report Resource Website 1+ mentions |
RRID:RGD_126925136 | Rattus norvegicus | ZFN constructs were designed to target the genomic region of rat Mstn exon 1. A ZFN construct engineered to target bp 277 to 281 of rat Mstn was used for the rat embryo injection. The # 6 founder was found to have sequence changed from GATCA to AGTC, resulting in a frame shift mutation within the open reading frame and generate an early termination codon, resulting in a truncated 109 amino acid peptide (wild type is 376). ZFN mutant founders were backcrossed to Spargue Dawley rats to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 126925136 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925136 | 2026-07-25 12:43:06 | 1 | |||||
|
F344-Depdc5em2Kyo+/- Resource Report Resource Website |
RRID:RGD_38599158 | Rattus norvegicus | TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. National BioResource Project for the Rat in Japan | 38599158 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38599158 | 2026-07-25 12:43:06 | 0 | |||||
|
F344-Depdc5em1Kyo+/- Resource Report Resource Website |
RRID:RGD_38599157 | Rattus norvegicus | TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. National Bio Resource Project Rat in Japan | 38599157 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38599157 | 2026-07-25 12:43:06 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
