Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 57 showing 1121 ~ 1140 out of 1,464 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_13792811

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792811

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 13792811
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a7-bp deletion in exon 2.

Proper citation: RRID:RGD_13792811 Copy   


  • RRID:RGD_12903267

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12903267

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2017-05-10)
References:
Synonyms:
Alternate IDs: 12903267
Notes: This model contains a ZFN-induced 10-bp deletion within rat Nr1i3 gene. Horizon Discovery

Proper citation: RRID:RGD_12903267 Copy   


  • RRID:RGD_13782353

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13782353

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 13782353
Notes: Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single-cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes.

Proper citation: RRID:RGD_13782353 Copy   


  • RRID:RGD_13782351

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13782351

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 13782351
Notes: Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is TCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single -cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes.

Proper citation: RRID:RGD_13782351 Copy   


  • RRID:RGD_13208519

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13208519

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2017-08-09)
References:
Synonyms:
Alternate IDs: 13208519
Notes: This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_13208519 Copy   


  • RRID:RGD_13208518

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13208518

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2017-08-09)
References:
Synonyms:
Alternate IDs: 13208518
Notes: This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_13208518 Copy   


  • RRID:RGD_13208517

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13208517

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2017-08-09)
References:
Synonyms:
Alternate IDs: 13208517
Notes: This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_13208517 Copy   


  • RRID:RGD_13793376

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13793376

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo (as of 2018-10-03)
References:
Synonyms:
Alternate IDs: 13793376
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13793376 Copy   


  • RRID:RGD_13503336

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13503336

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2018-01-12)
References:
Synonyms: , Acr {tm1 Osb}
Alternate IDs: 13503336
Notes: After homologous recombination using ES cells derived from hybrid (mix) breed of Slc:Wistar (female) and F344/NSlc (male), Acr KO strain was established by GLT at Osaka University. The genomic region including exon 1 to exon 3 is replaced by Neo resistance gene. After mating with Slc:Wistar, this strain is maintained by sib mating or with Slc:Wistar rats. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_13503336 Copy   


  • RRID:RGD_13204704

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13204704

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 13204704
Notes: Male Wistar founder rats were mutagenized using ENU and mated with untreated female to establish F1 population. Selected F1 progeny were mated to produce F2 and then to breed induced mutation to homozygosity.

Proper citation: RRID:RGD_13204704 Copy   


  • RRID:RGD_12910494

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12910494

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 12910494
Notes: The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion and 4-bp insertion in exon 4 of Ifnar1 gene.

Proper citation: RRID:RGD_12910494 Copy   


  • RRID:RGD_12910493

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12910493

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 12910493
Notes: The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion in exon 4 of Ifnar1 gene.

Proper citation: RRID:RGD_12910493 Copy   


  • RRID:RGD_14390067

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14390067

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 14390067
Notes: The Slc6a4 knockout rat was generated by target-selected ENU-induced mutagenesis. An ENU-induced premature stop codon in exon 3 of the Slc6a4 gene in a female rat (Wistar from Crl) was identified.The homozygoous mutant rats were generated by incrossed between heterozygous Slc6a4 knock out rats.

Proper citation: RRID:RGD_14390067 Copy   


  • RRID:RGD_42721974

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=42721974

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 42721974
Notes: The Lewis Polycystic Kidney (LPK) rat is a spontaneous mutant identified in the LEW colony (LEW/SsNArc) maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The causal gene is identified as a non-synonymous mutation R650C in the NIMA (never in mitosis gene a)- related kinase 8 ( Nek8) gene.

Proper citation: RRID:RGD_42721974 Copy   


  • RRID:RGD_42721977

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=42721977

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 42721977
Notes: Cpf1 mRNA (50 ng per uL) and CRISPR RNA (100 ng per uL) were co-microinjected into the cytoplasm of pronuclear stage embryos; surviving embryos were transplanted into the oviducts of pseudo-pregnant surrogate mothers to generate live animals. A Pde6b-mutant rat line with an 11-bp deletion in exon 1 was established. Western blot analysis confirmed deficiency of Pde6b protein in the homozygous mutant retina, indicating successful generation of Pde6b-deficient rats with Cpf1-mediated gene targeting.

Proper citation: RRID:RGD_42721977 Copy   


  • RRID:RGD_38599152

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599152

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 38599152
Notes: The mutant rats were created using N-ethyl-N-nitrosourea (ENU) mutagenesis. A point mutation in the 5'-end splice site of intron 18 resulting in mis-splicing, a reading frameshift, and a premature stop codon was identified. As this mutation does not induce nonsense-mediated decay, it allows the production of a truncated Lipin 1 protein lacking phosphatidate phosphatase 1 activity.

Proper citation: RRID:RGD_38599152 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925135

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 126925135
Notes: This line was produced by mating rats carrying IIl1rl2f/f allele and Myh6-cre-allele. The expression of Il1rl2 was knockout in cardiomyocytes.

Proper citation: RRID:RGD_126925135 Copy   


  • RRID:RGD_126925136

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925136

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 126925136
Notes: ZFN constructs were designed to target the genomic region of rat Mstn exon 1. A ZFN construct engineered to target bp 277 to 281 of rat Mstn was used for the rat embryo injection. The # 6 founder was found to have sequence changed from GATCA to AGTC, resulting in a frame shift mutation within the open reading frame and generate an early termination codon, resulting in a truncated 109 amino acid peptide (wild type is 376). ZFN mutant founders were backcrossed to Spargue Dawley rats to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_126925136 Copy   


  • RRID:RGD_38599158

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599158

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 38599158
Notes: TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_38599158 Copy   


  • RRID:RGD_38599157

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599157

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 38599157
Notes: TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. National Bio Resource Project Rat in Japan

Proper citation: RRID:RGD_38599157 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X