Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00034618
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; heSi148 X.
Alternate IDs: WB-STRAIN:SV1461
Notes: heSi148 [myo-3::CRE::tbb-2 UTR + unc-119(+)] X. Inserted at ttTi14024. Maintain at 15-25C. Expression of CRE recombinase in differentiated body wall muscle cells driven by the myo-3 promoter. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.|"No longer available from the CGC"
Proper citation: RRID:WB-STRAIN:WBStrain00034618 Copy
http://www.wormbase.org/db/get?name=WBStrain00034692
Source Database: WormBase (WB)
Affected Genes: WBGene00001052(dop-1)|WBGene00001053(dop-2)|WBGene00020506(dop-3)
Genomic Alteration: WBGene00001052(dop-1), WBGene00001053(dop-2), WBGene00020506(dop-3)
Availability: available
Source References: EMPTY
Synonyms: vtIs1 dop-2(vs105) V; dop-1(vs100) dop-3(vs106) X.
Alternate IDs: WB-STRAIN:TG2415, CGC_TG2415
Notes: vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
Proper citation: RRID:WB-STRAIN:WBStrain00034692 Copy
http://www.wormbase.org/db/get?name=WBStrain00034694
Source Database: WormBase (WB)
Availability: available
Source References: PMID:36719882, PMID:37528117, PMID:39950089, PMID:39746999
Synonyms: vtIs1 V.
Alternate IDs: WB-STRAIN:TG2435, CGC_TG2435
Notes: vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll well, but GFP expression is easily detected. Reference: Nass R, et al. Proc Natl Acad Sci U S A. 2002 Mar 5;99(5):3264-9. Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
Proper citation: RRID:WB-STRAIN:WBStrain00034694 Copy
http://www.wormbase.org/db/get?name=WBStrain00034697
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00008140(xpf-1)|WBGene00016602(mus-81)
Genomic Alteration: WBGene00000254(bli-4), WBGene00008140(xpf-1), WBGene00016602(mus-81)
Availability: available
Source References: EMPTY
Synonyms: mus-81(tm1937) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II; gtIs2512.
Alternate IDs: WB-STRAIN:TG2452, CGC_TG2452
Notes: gtIs2512 [pie-1p::his-11::GFP + unc-119(+)]. Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.
Proper citation: RRID:WB-STRAIN:WBStrain00034697 Copy
http://www.wormbase.org/db/get?name=WBStrain00034611
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: heSi101 I; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:SV1317, CGC_SV1317
Notes: heSi101 [tcc-1p::tcc-1::mCherry::tcc-1 3' UTR + Cbr-unc-119(+)] I. TCC-1::mCherry associates with the mitotic spindle, nuclear envelope, and plasma membrane. Reference: Berends CWH, et al. Mol Biol Cell. 2013 Jul;24(14):2201-15.|"no longer available from the CGC."
Proper citation: RRID:WB-STRAIN:WBStrain00034611 Copy
http://www.wormbase.org/db/get?name=WBStrain00034623
Source Database: WormBase (WB)
Affected Genes: WBGene00000962(dhc-1)
Genomic Alteration: WBGene00000962(dhc-1)
Availability: available
Source References: EMPTY
Synonyms: dhc-1(he264[eGFP::dhc-1]) I.
Alternate IDs: WB-STRAIN:SV1803, CGC_SV1803
Notes: This strain carries endogenously tagged dynein heavy chain (egfp::dhc-1). Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 27772793. doi: 10.1083/jcb.201607038
Proper citation: RRID:WB-STRAIN:WBStrain00034623 Copy
http://www.wormbase.org/db/get?name=WBStrain00034624
Source Database: WormBase (WB)
Affected Genes: WBGene00007062(ebp-3)|WBGene00012156(ebp-2)|WBGene00013344(ebp-1)
Genomic Alteration: WBGene00007062(ebp-3), WBGene00012156(ebp-2), WBGene00013344(ebp-1)
Availability: available
Source References: EMPTY
Synonyms: ebp-2(he278) II; ebp-1 & Y59A8B.25 & ebp-3(he279) V.
Alternate IDs: WB-STRAIN:SV1877, CGC_SV1877
Notes: he278 is a CRISPR-induced deletion of ebp-2. he279 is a deletion removing ebp-1, Y59A8B.25 & ebp-3. Low penetrance of pleiotropic phenotypes among adults, including low frequency of dumpy, sterile and/or uncoordinated animals and nonviable larvae that explode through the vulva. Some adults develop irregularities that seem to represent epidermal bulges. Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 27772793. doi: 10.1083/jcb.201607038
Proper citation: RRID:WB-STRAIN:WBStrain00034624 Copy
http://www.wormbase.org/db/get?name=WBStrain00034625
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: flvEx4.
Alternate IDs: WB-STRAIN:SWF5, CGC_SWF5
Notes: flvEx4 [rig-3p::wArchon1::GFP + sra-6::ChR2-GFP + elt-2p::nGFP]. Pick GFP+ to maintain. Voltage-sensor protein wArchon1 transgene injected into N2 background. Reference: Piatkevich KD, et al. Nature Chemical Biology. 2018. doi:10.1038/s41589-018-0004-9.|"Made_by: Steven Flavell"
Proper citation: RRID:WB-STRAIN:WBStrain00034625 Copy
http://www.wormbase.org/db/get?name=WBStrain00034629
Source Database: WormBase (WB)
Affected Genes: WBGene00004178(prg-1)|WBGene00006759(unc-22)
Genomic Alteration: WBGene00004178(prg-1), WBGene00006759(unc-22)
Availability: available
Source References: PMID:31839537
Synonyms: prg-1(n4357) I.
Alternate IDs: WB-STRAIN:SX158, CGC_SX158
Notes: 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT|"Mutagen:EMS/Tc3"|"Twitching due to transposon insertion in unc-22."|"Twitching due to transposon insertion in unc-22. [(07/16/2018) NOTE: A user has reported their PCR and sequence analysis suggest this strain contains does not still contain Tc3, but retains loss unc-22 function, apparently due to imprecise excision.]"
Proper citation: RRID:WB-STRAIN:WBStrain00034629 Copy
http://www.wormbase.org/db/get?name=WBStrain00034620
Source Database: WormBase (WB)
Affected Genes: WBGene00004203(swsn-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004203(swsn-1), WBGene00006843(unc-119)
Availability: available
Source References: PMID:32494730
Synonyms: unc-119(ed3) III; heIs105 IV; swsn-1(os22) heSi164 V; heSi141 X.
Alternate IDs: WB-STRAIN:SV1578, CGC_SV1578
Notes: heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi164 [rps-27::loxN::NLS::mCherry::let858 UTR::swsn-1p::swsn-1::unc-54 UTR::loxN::NLS::GFP::let-858 UTR + unc-119(+)] V. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain the line at 15C and shift to 25C for mutant analysis. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi164 carries a swsn-1 rescue construct which ensures rescue of the temperature-sensitive swsn-1(os22) mutation. Upon expression of CRE (in this case in the mesoblast lineage) the swsn-1 gene will be excised, creating a mesoblast specific mutant of swsn-1. This recombination event can be visualized by a switch from red to green in those mesoblast cells in which swsn-1 was lost. The animals are healthy at 15C, but embryonic lethal and larval arrested at 23-25C. swsn-1(os22) causes mild overproliferation in the mesoblast lineage. The swsn-1 rescuing transgene is unable to rescue germline development of swsn-1(os22) mutants. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
Proper citation: RRID:WB-STRAIN:WBStrain00034620 Copy
http://www.wormbase.org/db/get?name=WBStrain00034678
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ltIs37 IV. gtIs67.
Alternate IDs: WB-STRAIN:TG1756, CGC_TG1756
Notes: gtIs67 [pie-1p::GFP(lap)::sld-5 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
Proper citation: RRID:WB-STRAIN:WBStrain00034678 Copy
http://www.wormbase.org/db/get?name=WBStrain00034670
Source Database: WormBase (WB)
Affected Genes: WBGene00006643(tsp-17)
Genomic Alteration: WBGene00006643(tsp-17)
Availability: available
Source References: EMPTY
Synonyms: vtIs1 V; tsp-17(gt1681) X.
Alternate IDs: WB-STRAIN:TG1681, CGC_TG1681
Notes: vtIs1 [dat-1p::GFP + rol-6] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
Proper citation: RRID:WB-STRAIN:WBStrain00034670 Copy
http://www.wormbase.org/db/get?name=WBStrain00034671
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ltIs37 IV; gtIs60.
Alternate IDs: WB-STRAIN:TG1749, CGC_TG1749
Notes: gtIs60 [pie-1p::GFP(lap)::orc-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
Proper citation: RRID:WB-STRAIN:WBStrain00034671 Copy
http://www.wormbase.org/db/get?name=WBStrain00034673
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ltIs37 IV; gtIs62.
Alternate IDs: WB-STRAIN:TG1751, CGC_TG1751
Notes: gtIs62 [pie-1p::GFP(lap)::cdc-6 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
Proper citation: RRID:WB-STRAIN:WBStrain00034673 Copy
http://www.wormbase.org/db/get?name=WBStrain00034675
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ltIs37 IV; gtIs64.
Alternate IDs: WB-STRAIN:TG1753, CGC_TG1753
Notes: gtIs64 [pie-1p::GFP(lap)::mcm-3 + unc-119(+)]. ltIs37 [(pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
Proper citation: RRID:WB-STRAIN:WBStrain00034675 Copy
http://www.wormbase.org/db/get?name=WBStrain00034676
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ltIs37 IV; gtIs65.
Alternate IDs: WB-STRAIN:TG1754, CGC_TG1754
Notes: gtIs65 [pie-1p::GFP(lap)::cdc-45 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
Proper citation: RRID:WB-STRAIN:WBStrain00034676 Copy
http://www.wormbase.org/db/get?name=WBStrain00034677
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ltIs37 IV; gtIs66.
Alternate IDs: WB-STRAIN:TG1755, CGC_TG1755
Notes: gtIs66 [pie-1p::GFP(lap)::div-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
Proper citation: RRID:WB-STRAIN:WBStrain00034677 Copy
http://www.wormbase.org/db/get?name=WBStrain00034680
Source Database: WormBase (WB)
Affected Genes: WBGene00018909(slx-1)
Genomic Alteration: WBGene00018909(slx-1)
Availability: available
Source References: PMID:36176234
Synonyms: slx-1(tm2644) I.
Alternate IDs: WB-STRAIN:TG1868, CGC_TG1868
Notes: Reference: Agostinho A, et al. PLos Genetics 2013.|"Supplementary_genotype slx-1(tm2644)"
Proper citation: RRID:WB-STRAIN:WBStrain00034680 Copy
http://www.wormbase.org/db/get?name=WBStrain00034602
Source Database: WormBase (WB)
Affected Genes: WBGene00000870(cyd-1)|WBGene00001072(dpy-10)|WBGene00004394(rol-1)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00000870(cyd-1), WBGene00001072(dpy-10), WBGene00004394(rol-1), WBGene00006787(unc-52)
Availability: available
Source References: EMPTY
Synonyms: rol-1(e91) cyd-1(he112)/mnC1 [dpy-10(e28) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:SV314, CGC_SV314
Notes: Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1.
Proper citation: RRID:WB-STRAIN:WBStrain00034602 Copy
http://www.wormbase.org/db/get?name=WBStrain00034603
Source Database: WormBase (WB)
Affected Genes: WBGene00000383(cdc-14)
Genomic Alteration: WBGene00000383(cdc-14)
Availability: available
Source References: EMPTY
Synonyms: cdc-14(he118) II.
Alternate IDs: WB-STRAIN:SV327, CGC_SV327
Notes: Extra cell divisions within several cell lineages.|"Made_by: R.M. Saito"
Proper citation: RRID:WB-STRAIN:WBStrain00034603 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.