Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 34 showing 661 ~ 680 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00063357

Source Database: WormBase (WB)
Affected Genes: WBGene00019322(ahcy-1)
Genomic Alteration: WBGene00019322(ahcy-1)
Availability: unknown
Source References: EMPTY
Synonyms: ahcy-1(syb646[ahcy-1::GFP]) I.
Notes: GFP tag inserted at C-terminus of endogenous ahcy-1 locus. Derived by out-crossing parental strain PHX646 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.|"Made_by: SunyBiotech"

Proper citation: RRID:WB-STRAIN:WBStrain00063357 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063358

Source Database: WormBase (WB)
Affected Genes: WBGene00019322(ahcy-1)
Genomic Alteration: WBGene00019322(ahcy-1)
Availability: unknown
Source References: EMPTY
Synonyms: ahcy-1(syb784 *syb646[ahcy-1(Y145C)::GFP]) I.
Notes: Engineered Y145C substitution mutation in endogenously GFP-tagged ahcy-1 locus. ahcy-1(Y145C) mutation mimics the pathogenic human mutation AHCY Y143C. ahcy-1(Y145C) mutants have a prolonged lifespan and are larger than control animals. ahcy-1(Y145C) mutants are fertile and produce a brood of laid and hatched eggs similar to control animals. ahcy-1(Y145C) mutants show a slight increase in SAH and a decrease in SAM levels, leading to an increased SAH to SAM ratio. See WOP122 for control strain. Derived by out-crossing parental strain PHX784 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.|"Made_by: SunyBiotech"

Proper citation: RRID:WB-STRAIN:WBStrain00063358 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063355

Source Database: WormBase (WB)
Affected Genes: WBGene00012474(attf-6)
Genomic Alteration: WBGene00012474(attf-6)
Availability: unknown
Source References: EMPTY
Synonyms: attf-6(how51[GFP::TEV::AID::attf-6]) I; wrdSi51 II.
Notes: Made_by: Yi-hui Wang|"wrdSi51 [mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). GFP::TEV::AID tag inserted at the N-terminus of the endogenous attf-6 locus facilitates auxin-inducible degradation of GFP::TEV::AID::ATTF-6. Reference: Wang Y, et al. Nucleic Acids Research. 2025 Feb 28; 53(4): gkaf079. doi: 10.1093/nar/gkaf079 PMID: 39945323."

Proper citation: RRID:WB-STRAIN:WBStrain00063355 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063356

Source Database: WormBase (WB)
Affected Genes: WBGene00012474(attf-6)
Genomic Alteration: WBGene00012474(attf-6)
Availability: unknown
Source References: EMPTY
Synonyms: WHY546 attf-6(how52[attf-6::3xflag]) I.
Notes: 3xFlag tag inserted at the C-terminus of the endogenous attf-6 locus. Reference: Wang Y, et al. Nucleic Acids Research. 2025 Feb 28; 53(4): gkaf079. doi: 10.1093/nar/gkaf079 PMID: 39945323.|"Made_by: Yi-Hui Wang"

Proper citation: RRID:WB-STRAIN:WBStrain00063356 Copy   

    • RRID:WB-STRAIN:WBStrain00043989

http://www.wormbase.org/db/get?name=WBStrain00043989

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38719808, PMID:38878153
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data

Proper citation: RRID:WB-STRAIN:WBStrain00043989 Copy   

    • RRID:WB-STRAIN:WBStrain00043477

http://www.wormbase.org/db/get?name=WBStrain00043477

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data

Proper citation: RRID:WB-STRAIN:WBStrain00043477 Copy   

    • RRID:WB-STRAIN:WBStrain00046622

http://www.wormbase.org/db/get?name=WBStrain00046622

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data

Proper citation: RRID:WB-STRAIN:WBStrain00046622 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063342

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019877(lmbr-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019877(lmbr-1)
Availability: unknown
Source References: EMPTY
Synonyms: +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ lmbr-1(hd7180 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III.
Notes: Made_by: VH KO group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7180 and CGC66. hd7180 is a 1876 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCTTTTTACAGATTTAATAACACCAAAT; Right flanking sequence: TGGCTACAAATACCTTGAAATTGTTATTCG. sgRNA #1: GGCCCAATACGCCCTGGAGG; sgRNA #2: GACATGCTCTCTAATCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00063342 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063340

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019276(algn-5)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019276(algn-5)
Availability: unknown
Source References: EMPTY
Synonyms: +/nT1 [umnls49] IV; algn-5 (hd7175[loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/nT1 V.
Notes: Made_by: VH KO group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7175 and CGC63. hd7175 is a 1325 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCAAAAAATCAATATCTTCACCATTTTCA; Right flanking sequence: TGGAGCTACAAAATTCGCCGATTTTGAAAA. sgRNA #1: GACTTTCCTACGCAACACCA; sgRNA #2: ATTCTCTTCGCAGATGCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00063340 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063341

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010427(hpo-11)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010427(hpo-11)
Availability: unknown
Source References: EMPTY
Synonyms: hpo-11 (hd7177 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) /hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III.
Notes: Made_by: VH KO group|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7177 and CGC92. hd7177 is a 7087 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GATGGTCCATTTGTATTAGTTGTTGTACCA; Right flanking sequence: TTTTAGTTGGAACGGCTCGCGCCCAAGCAG. sgRNA #1: CTTGGCTGTGATGATTGACC; sgRNA #2: AAACGGAACAAGGACACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00063341 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063347

Source Database: WormBase (WB)
Affected Genes: WBGene00016968(epg-5)
Genomic Alteration: WBGene00016968(epg-5)
Availability: unknown
Source References: EMPTY
Synonyms: epg-5(tm3425) II; vkIs3785 X.
Notes: Made_by: Zachary D. Dawson|"vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. GFP aggregation in intestine. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663."

Proper citation: RRID:WB-STRAIN:WBStrain00063347 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063348

Source Database: WormBase (WB)
Affected Genes: WBGene00021922(atg-3)
Genomic Alteration: WBGene00021922(atg-3)
Availability: unknown
Source References: EMPTY
Synonyms: atg-3(bp412) IV; vkIs3785 X.
Notes: Made_by: Zachary D. Dawson|"vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. Stronger GFP expression in intestine than in wild-type background. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663."

Proper citation: RRID:WB-STRAIN:WBStrain00063348 Copy   

    • RRID:WB-STRAIN:WBStrain00045019

http://www.wormbase.org/db/get?name=WBStrain00045019

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data

Proper citation: RRID:WB-STRAIN:WBStrain00045019 Copy   

    • RRID:WB-STRAIN:WBStrain00063349

http://www.wormbase.org/db/get?name=WBStrain00063349

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: wbmIs79 *wbmIs67 V.
Notes: wbmIs79 [eft-3p::3XFLAG::raga-1::SL2::wrmScarlet::unc-54 3'UTR] *wbmIs67. Somatic-specific RAGA-1 and wrmScarlet expression driven by the eft-3p promoter. Derived by CRISPR-mediated insertion of raga-1 downstream of tissue-specific eft-3 promoter of wbmIs67 insertion in parental strain WBM1143. wbmIs67 [eft-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs65] (V:8645000). Reference: Zhang Y, et al. Elife. 2019 Aug 14;8:e49158. doi: 10.7554/eLife.49158. PMID: 31411562.

Proper citation: RRID:WB-STRAIN:WBStrain00063349 Copy   

    • RRID:WB-STRAIN:WBStrain00046349

http://www.wormbase.org/db/get?name=WBStrain00046349

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data

Proper citation: RRID:WB-STRAIN:WBStrain00046349 Copy   

    • RRID:WB-STRAIN:WBStrain00044818

http://www.wormbase.org/db/get?name=WBStrain00044818

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on CalTech XREF data

Proper citation: RRID:WB-STRAIN:WBStrain00044818 Copy   

    • RRID:WB-STRAIN:WBStrain00046681

http://www.wormbase.org/db/get?name=WBStrain00046681

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data

Proper citation: RRID:WB-STRAIN:WBStrain00046681 Copy   

    • RRID:WB-STRAIN:WBStrain00045074

http://www.wormbase.org/db/get?name=WBStrain00045074

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data

Proper citation: RRID:WB-STRAIN:WBStrain00045074 Copy   

    • RRID:WB-STRAIN:WBStrain00045065

http://www.wormbase.org/db/get?name=WBStrain00045065

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Notes: Generated based on WC-CalTech XREF data

Proper citation: RRID:WB-STRAIN:WBStrain00045065 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063339

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C09B9.85(hd7184[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 3777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTGTGCAGATCCAACTAGGGCGTCTCCA; Right flanking sequence: AGGAAATTTTTGTCGAAAATTCTGAAAAAT. sgRNA #1: CATGGTATGGATGGAAGCAT; sgRNA #2: CAAAGTTAGCAATTTTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00063339 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch