Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
W01A11.1(ve935[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063035 | Caenorhabditis elegans | W01A11.1(ve935[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 2962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCGTTGCAATCGGGGTTCTCGCCGCCG ; Right flanking sequence: AGGTCTCCCGTCATTCCTATAACATCACCC. W01A11.1 sgRNA A: CGGCAACAAATTCCATACGG; W01A11.1 sgRNA B: CTATGACCGTACACCAATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063035 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
nep-11(ve833[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062981 | Caenorhabditis elegans | nep-11(ve833[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 2722 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATATCTTCGAATCTCTCATCCAAGTACCT ; Right flanking sequence: TTTCACTGATAGTTATCAGTTGCATCTGAC. sgRNA #1: GAGTTGTCCAGTCAAACGTG; sgRNA #2: ATAGTGATATACCTACTCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017557(nep-11) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017557(nep-11) | WB-STRAIN:WBStrain00062981 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
gln-5(ve937[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063037 | Caenorhabditis elegans | gln-5(ve937[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 1358 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCCAATTGAAAGCTAAAAATTCAGAAAGAT ; Right flanking sequence: TTGACCGAGAGGAAGACGAGTTTCGTAGTT. gln-5 sgRNA A: CATGCGTTAGTTTATTCGGG; gln-5 sgRNA B: GCCACCATCGATCATTTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00001606(gln-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001606(gln-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063037 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
Y38C1AA.6(ve881[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062987 | Caenorhabditis elegans | Y38C1AA.6(ve881[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 851 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTGAACAATGTTTCGATCAAAAACATTCCC ; Right flanking sequence: CGGTGTTGGAGTGTTTCAATGAAGATGATG. Y38C1AA.6 sgRNA #1: GTTGCAAATTGGGCATGAAG; Y38C1AA.6 sgRNA #2: AGATTTCCAACTTATTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062987 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
clec-86(ve922[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063023 | Caenorhabditis elegans | clec-86(ve922[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 512 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cttgtcgcgcttttgtgttttgtgtCACCA ; Right flanking sequence: CCCACCATGTCCATCTTGTTCTAAATAACT. clec-86 sgRNA A: GTATCTCCAGGAAGACAATT; clec-86 sgRNA B: CATGTGTACGATCCTCCAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016912(clec-86) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016912(clec-86) | WB-STRAIN:WBStrain00063023 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
gsto-1(ve926[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063027 | Caenorhabditis elegans | gsto-1(ve926[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 1355 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGACTGGTTTTAATATCAAAGGCCCAAATC ; Right flanking sequence: AGGTTCCGCATCTCCTTTTCGAATTGCTTT. gsto-1 sgRNA A: ATAATTCAATTCCTGGTGCG; gsto-1 sgRNA B: AAAGATCCCTTTGATAGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016204(gsto-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016204(gsto-1) | WB-STRAIN:WBStrain00063027 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
Caenorhabditis sp. 74 wild isolate. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062973 | Caenorhabditis sp. 74 | Caenorhabditis sp. 74 wild isolate. | Male/Female, maintain by mating. Isofemale line isolated from rotting breadfruit flowers in Kitti, Pohnpei, Micronesia (N 6.8632, E 158.1765), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation. | WB-STRAIN:WBStrain00062973 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||||
|
cuc-1(syb1006) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062971 | Caenorhabditis elegans | cuc-1(syb1006) III. | cuc-1 null mutant. Grows well on standard media but has a slightly reduced brood size and ~10% of gonad arms show a migration defect. Reference: Zhang X, et al. Biometals. 2020 Jun;33(2-3):147-157. doi: 10.1007/s10534-020-00239-z. PMID: 32506305.|"Made_by: Xiaolu Zhang" | WBGene00000835(cuc-1) | WBGene00000835(cuc-1) | WB-STRAIN:WBStrain00062971 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
Caenorhabditis sp. 75 wild isolate. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062976 | Caenorhabditis sp. 75 | Caenorhabditis sp. 75 wild isolate. | Male/Female, maintain by mating. Isofemale line isolated from rotting kotop (Clinostigma ponapensis) fruit in Kitti, Pohnpei, Micronesia (N 6.8577, E 158.2156), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation. | WB-STRAIN:WBStrain00062976 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||||
|
hIn1 [umnIs78 unc-54(h1040)]/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062977 | Caenorhabditis elegans | hIn1 [umnIs78 unc-54(h1040)]/+ I. | Made_by: Yvan Doctorovich|"umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim mKate2 expression in pharynx, and segregate heterozygotes (not paralyzed, dim mKate2), homozygous wild-type (not paralyzed, no mKate2), and hIn1 homozygotes (paralyzed, bright mKate2). Pick non-paralyzed, dim mKate2 worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived by crossing parental strain CGC105 (hIn1[umnIs78]) to RG3173 (Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)]) and selecting for the recombined hIn1 worms." | WBGene00006789(unc-54) | WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062977 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
Caenorhabditis sp. 72 wild isolate. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062974 | Caenorhabditis sp. 72 | Caenorhabditis sp. 72 wild isolate. | Male/Female, maintain by mating. Isofemale line isolated from rotting Citrus aurantifolia in Kitti, Pohnpei, Micronesia (N 6.8652, E 158.173), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation. | WB-STRAIN:WBStrain00062974 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||||
|
cal-1(ve928[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063029 | Caenorhabditis elegans | cal-1(ve928[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 1987 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTACGAACTCTTCGTAATCAATTTCCCC ; Right flanking sequence: CGGTTTGCTTACCATATCTCTGGCGAGTCG. cal-1 sgRNA A: AAGTTGATGTGGATGGAGAC; cal-1 sgRNA B: TTCATGCTCCATGTTAGTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00000285(cal-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000285(cal-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063029 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:49 | 0 | ||||
|
cutl-18(syb8442[mNG::cutl-18]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062967 | Caenorhabditis elegans | cutl-18(syb8442[mNG::cutl-18]) V. | Made_by: SUNY Biotech|"mNeonGreen tag inserted into endogenous cutl-18 locus using CRISPR/Cas9. mNeonGreen tag inserted just after endogenous signal sequence. Reference: Schmidt HF, et al. 2025 Jan:517:265-277. doi: 10.1016/j.ydbio.2024.10.008. PMID: 39489317." | WBGene00009830(cutl-18) | WBGene00009830(cutl-18) | WB-STRAIN:WBStrain00062967 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
tsp-20(ve909[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063011 | Caenorhabditis elegans | tsp-20(ve909[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTGGGGCTATCACTCAAAGCACAGCCCT ; Right flanking sequence: AGGTATGAAATGAACAATTGACATTTTGAA. tsp-20 sgRNA A: CAAGAGTACACATCAACGGA; tsp-20 sgRNA B: AAACTATACTTACCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006646(tsp-20)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006646(tsp-20), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063011 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
taf-8(ve915[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063016 | Caenorhabditis elegans | taf-8(ve915[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. | Made_by: RG KO Group|"umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1934 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve915 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny.Left flanking Sequence: GAATGCTTCCTCAACACAATACATTTATTA ; Right flanking sequence: ACGACTACGGCAATTATGAGGATGAAGAGA. taf-8 sgRNA A: GGAGACCGACTATTGCAGGA; taf-8 sgRNA B: TGTCGCGTATCGGAGGGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006390(taf-8)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006390(taf-8), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063016 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
hlh-15(syb7688 [hlh-15::GFP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062962 | Caenorhabditis elegans | hlh-15(syb7688 [hlh-15::GFP]) X. | Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech" | WBGene00001959(hlh-15) | WBGene00001959(hlh-15) | WB-STRAIN:WBStrain00062962 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
ZC190.4(ve913[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063014 | Caenorhabditis elegans | ZC190.4(ve913[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:AAAAAGTTGCGACTCCATAAATATGCTCCT ; Right flanking sequence:TTTCAATTTACAAAAATAGGTTAGCCATGT. ZC190.4 sgRNA #1:TATGTCATGTCTTGGAAGAG ZC190.4 sgRNA #2:GATGGGGTTATTACACAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063014 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
col-93::mNG(syb7695) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062963 | Caenorhabditis elegans | col-93::mNG(syb7695) III. | Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous col-93 locus." | WBGene00000668(col-93) | WBGene00000668(col-93) | WB-STRAIN:WBStrain00062963 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
Y38C1AA.19(ve917[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063018 | Caenorhabditis elegans | Y38C1AA.19(ve917[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 1665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTCCTAAGTTATTTTCTTATCGGACTCCT ; Right flanking sequence: tttcggctgttttccggctggcagcgAGTT. Y38C1AA.19 sgRNA A: CATTTTATTGACGACTGATA; Y38C1AA.19 sgRNA B: aactatacgttgtcggctgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063018 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 | ||||
|
col-71::mNG(syb8144) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062964 | Caenorhabditis elegans | col-71::mNG(syb8144) II. | Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous col-71 locus." | WBGene00000647(col-71) | WBGene00000647(col-71) | WB-STRAIN:WBStrain00062964 | WormBase (WB) | WB | unknown | 2026-09-05 04:59:48 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.