Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
Ctr-lim-6(ot1392[Ctr-lim-6::GFP]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062846 Caenorhabditis tropicalis Ctr-lim-6(ot1392[Ctr-lim-6::GFP]) X. C-terminal GFP tag inserted before STOP codon of endogenous Ctr-lim-6 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:|"Made_by: Itai Toker" WBGene00002988(lim-6) WBGene00002988(lim-6) WB-STRAIN:WBStrain00062846 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
him-5(e1490) V; otIs810.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062840 Caenorhabditis elegans him-5(e1490) V; otIs810. Made_by: Cyril Cros|"otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1]." WBGene00001864(him-5) WBGene00001864(him-5) WB-STRAIN:WBStrain00062840 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
Cbr-eat-4(ot1371[Cbr-eat-4::T2A::GFP::H2B]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062841 Caenorhabditis briggsae Cbr-eat-4(ot1371[Cbr-eat-4::T2A::GFP::H2B]) III. Made_by: Itai Toker|"T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:" WBGene00001135(eat-4) WBGene00001135(eat-4) WB-STRAIN:WBStrain00062841 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
lim-6(ot1391[lim-6::GFP]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062845 Caenorhabditis elegans lim-6(ot1391[lim-6::GFP]) X. C-terminal GFP tag inserted before STOP codon of endogenous lim-6 locus using CRISPR/Cas9. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:|"Made_by: Itai Toker" WBGene00002988(lim-6) WBGene00002988(lim-6) WB-STRAIN:WBStrain00062845 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
Cbr-unc-25(ot1373[Cbr-unc-25::T2A::GFP::H2B]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062842 Caenorhabditis briggsae Cbr-unc-25(ot1373[Cbr-unc-25::T2A::GFP::H2B]) III. Made_by: Itai Toker|"T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:" WBGene00006762(unc-25) WBGene00006762(unc-25) WB-STRAIN:WBStrain00062842 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062839 Caenorhabditis elegans daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: WBGene00000912(daf-16)|WBGene00002084(ins-1) WBGene00000912(daf-16), WBGene00002084(ins-1) WB-STRAIN:WBStrain00062839 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
cdh-4(syb6764[cdh-4::GFP]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062948 Caenorhabditis elegans cdh-4(syb6764[cdh-4::GFP]) III. Made_by: SUNY Biotech|"SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-4 locus." WBGene00000396(cdh-4) WBGene00000396(cdh-4) WB-STRAIN:WBStrain00062948 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
hlh-17 hlh-31(syb6635) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062945 Caenorhabditis elegans hlh-17 hlh-31(syb6635) IV. CRISPR/Cas9-engineered 5421 bp deletion entirely removing both hlh-17 and hlh-31. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech" WBGene00001961(hlh-17)|WBGene00009540(hlh-31) WBGene00001961(hlh-17), WBGene00009540(hlh-31) WB-STRAIN:WBStrain00062945 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
hlh-17 hlh-31(syb6635) hlh-32(syb6773) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062949 Caenorhabditis elegans hlh-17 hlh-31(syb6635) hlh-32(syb6773) IV. Made_by: SunyBiotech|"Triple mutant for hlh-17, hlh-31, and hlh-32. CRISPR/Cas9-engineered 1691 bp deletion of the entire hlh-32 locus in hlh-17 hlh-31(syb6635) double mutant parental strain. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329" WBGene00001961(hlh-17)|WBGene00009540(hlh-31)|WBGene00013665(hlh-32) WBGene00001961(hlh-17), WBGene00009540(hlh-31), WBGene00013665(hlh-32) WB-STRAIN:WBStrain00062949 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
hlh-32(syb6078[hlh-32::GFP]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062940 Caenorhabditis elegans hlh-32(syb6078[hlh-32::GFP]) IV. Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech" WBGene00013665(hlh-32) WBGene00013665(hlh-32) WB-STRAIN:WBStrain00062940 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
ins-35(syb6236[ins-35::SL2::GFP::his-44]) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062943 Caenorhabditis elegans ins-35(syb6236[ins-35::SL2::GFP::his-44]) V. Made_by: Suny Biotech|"SL2::GFP::HIS-44 tag inserted into the endogenous ins-35 locus. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:" WBGene00001918(his-44)|WBGene00002118(ins-35) WBGene00001918(his-44), WBGene00002118(ins-35) WB-STRAIN:WBStrain00062943 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
hlh-17(syb6303[hlh-17::GFP]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062944 Caenorhabditis elegans hlh-17(syb6303[hlh-17::GFP]) IV. Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech" WBGene00001961(hlh-17) WBGene00001961(hlh-17) WB-STRAIN:WBStrain00062944 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
hlh-31(syb6112[hlh-31::GFP]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062941 Caenorhabditis elegans hlh-31(syb6112[hlh-31::GFP]) IV. Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech" WBGene00009540(hlh-31) WBGene00009540(hlh-31) WB-STRAIN:WBStrain00062941 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
Y51H7BR.7(ve891[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062995 Caenorhabditis elegans Y51H7BR.7(ve891[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 2929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAATTTTTCACCAATTGCTGCACGGGCACC ; Right flanking sequence: GCCTGAGACATTTTGTGTccaaaaaaagac. Y51H7BR.7 sgRNA A: AGCTCAGGAAGTCCGCCCGG; Y51H7BR.7 sgRNA B: TAGTTCCGCCAAACACGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00062995 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
Y67A6A.1(ve896[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062999 Caenorhabditis elegans Y67A6A.1(ve896[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Homozygous viable. Deletion of 583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTATTAAAATACAATACTAAAAGATTCCT ; Right flanking sequence: CTTTTATGCTACGAACGCAGTGAAAAACTC. Y67A6A.1 sgRNA A: GTCGAGAAACTGAAGCAAAA; Y67A6A.1 sgRNA B: CTCTGCTCGAGTCACAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00062999 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
marc-3(ve893[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062997 Caenorhabditis elegans marc-3(ve893[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Homozygous viable. Deletion of 1895 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCAAGAGTCTCCACATGGAAACGACCT ; Right flanking sequence: CGCTGGACCCAGCGATGCGTTGAAGTCTTC. marc-3 sgRNA #1: GTAACTATTGATTCGCAACG; marc-3 sgRNA #2: GTGTGTCGGATATGTATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007643(marc-3) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007643(marc-3) WB-STRAIN:WBStrain00062997 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
slc-17.1(ve883[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062989 Caenorhabditis elegans slc-17.1(ve883[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 3946 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGATATGTTGACCATCTATTCCAGCTGTCC ; Right flanking sequence: TTCGAGAGCCAGTTAGAACTCAAAATGAGT. slc-17.1 sgRNA A: GACAAAGGAAGTGTGCTCTG; slc-17.2 sgRNA B: ACGTTGTGCGAAAAAGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00062989 WormBase (WB) WB unknown 2026-09-05 04:59:48 0
R02F2.1(ve930[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063030 Caenorhabditis elegans R02F2.1(ve930[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 4303 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCATCTTCTACTGTCATTTCCAAATTCCCA ; Right flanking sequence: CTCTCATACTAATACAAATTCTATATATAT. R02F2.1 sgRNA A: CTCGTCTTCGTTCTGTAACA; R02F2.1 sgRNA B: AGATGGTGTGTGGGGGAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00063030 WormBase (WB) WB unknown 2026-09-05 04:59:49 0
gsto-2(ve934[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00063034 Caenorhabditis elegans gsto-2(ve934[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 1049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGTGCAATTTGTCATCATGTAGGCTTCCG ; Right flanking sequence: TGGATTGTAAATATCTTCTCTTCGTTACAA. gsto-2 sgRNA A: GGGAAGGAAGTAAACACAGG; gsto-2 sgRNA B: GGAGCACCAAACTTTGACTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00015337(gsto-2) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00015337(gsto-2) WB-STRAIN:WBStrain00063034 WormBase (WB) WB unknown 2026-09-05 04:59:49 0
skpo-2(ve832[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6[dpy-2(tmIs1208)] II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062980 Caenorhabditis elegans skpo-2(ve832[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6[dpy-2(tmIs1208)] II. Made_by: RG KO Group|"tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." WBGene00001064(dpy-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00015841(skpo-2) WBGene00001064(dpy-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00015841(skpo-2) WB-STRAIN:WBStrain00062980 WormBase (WB) WB unknown 2026-09-05 04:59:48 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.