Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00062870
Source Database: WormBase (WB)
Affected Genes: WBGene00004010(pha-1)
Genomic Alteration: WBGene00004010(pha-1)
Availability: unknown
Source References: EMPTY
Synonyms: pha-1 (e2123) III; otEx8199.
Notes: Made_by: Robert Aguilar|"otEx8199 [sshk-1p::GFP + pha-1(+)]. Maintain at 25C. 370 bp of promoter directly upstream of sshk-1 fused to GFP. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329"
Proper citation: RRID:WB-STRAIN:WBStrain00062870 Copy
http://www.wormbase.org/db/get?name=WBStrain00062873
Source Database: WormBase (WB)
Affected Genes: WBGene00013914(lgc-37)
Genomic Alteration: WBGene00013914(lgc-37)
Availability: unknown
Source References: EMPTY
Synonyms: Cbr-lgc-37(ot1475[Cbr-lgc-37::T2A::mScarlet3::H2B]) III.
Notes: Made_by: Itai Toker|"T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-lgc-37 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00062873 Copy
http://www.wormbase.org/db/get?name=WBStrain00062874
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs913 V.
Notes: otIs913 [pha-4(prom2)::daf-2(DN)::eBFP2::tbb-2 3 UTR + unc-122p::mCherry::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. pha-4(prom2) drives expression of daf-2(DN) in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00062874 Copy
http://www.wormbase.org/db/get?name=WBStrain00062878
Source Database: WormBase (WB)
Affected Genes: WBGene00016558(pks-1)
Genomic Alteration: WBGene00016558(pks-1)
Availability: unknown
Source References: EMPTY
Synonyms: pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X.
Notes: Made_by: Daniel Merritt (Hobert Lab)|"SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https:"
Proper citation: RRID:WB-STRAIN:WBStrain00062878 Copy
http://www.wormbase.org/db/get?name=WBStrain00062875
Source Database: WormBase (WB)
Affected Genes: WBGene00306126(cone-1)
Genomic Alteration: WBGene00306126(cone-1)
Availability: unknown
Source References: EMPTY
Synonyms: cone-1(ot1485[*syb5500[cone-1::oxGFP]]) III.
Notes: Made_by: Michael Cesar|"syb5500 is an oxGFP tag inserted at the C-terminus of the endogenous cone-1 locus by CRISPR. ot1485 is an early stop codon introduced into exon 3 of the endogenously-tagged cone-1 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain."
Proper citation: RRID:WB-STRAIN:WBStrain00062875 Copy
http://www.wormbase.org/db/get?name=WBStrain00062876
Source Database: WormBase (WB)
Affected Genes: WBGene00000464(ceh-44)
Genomic Alteration: WBGene00000464(ceh-44)
Availability: unknown
Source References: EMPTY
Synonyms: ceh-44(ot1486[*ot1015[ceh-44::gfp]]) III.
Notes: Made_by: Michael Cesar|"ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1468 is an early stop codon introduced into exon 3 of the endogenously-tagged ceh-44 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain."
Proper citation: RRID:WB-STRAIN:WBStrain00062876 Copy
http://www.wormbase.org/db/get?name=WBStrain00062904
Source Database: WormBase (WB)
Affected Genes: WBGene00006543(tbx-2)
Genomic Alteration: WBGene00006543(tbx-2)
Availability: unknown
Source References: EMPTY
Synonyms: tbx-2(cu37[tbx-2::TY1::GFP::FLAG *bx59]) III.
Notes: Made_by: Akshaya Rajaraman|"TY1::EGFP::3xFLAG tag inserted in frame at stop codon of the endogenous mutant tbx-2(bx59) coding sequence by CRISPR/Cas9 genome editing. Maintain at 15C. Lethal at 25C."
Proper citation: RRID:WB-STRAIN:WBStrain00062904 Copy
http://www.wormbase.org/db/get?name=WBStrain00062868
Source Database: WormBase (WB)
Affected Genes: WBGene00000464(ceh-44)
Genomic Alteration: WBGene00000464(ceh-44)
Availability: unknown
Source References: EMPTY
Synonyms: ceh-44(ot1447[*ot1015[ceh-44::gfp]]) III.
Notes: Made_by: Michael Cesar|"ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1447 is a deletion removing exon 5 of the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain."
Proper citation: RRID:WB-STRAIN:WBStrain00062868 Copy
http://www.wormbase.org/db/get?name=WBStrain00062907
Source Database: WormBase (WB)
Affected Genes: WBGene00020808(clik-1)
Genomic Alteration: WBGene00020808(clik-1)
Availability: unknown
Source References: EMPTY
Synonyms: clik-1(kt1[clik-1::gfp]) V.
Notes: GFP tag inserted into endogenous clik-1 locus. CLIK-1::GFP is expressed in body wall muscle, vulval muscle, and myoepithelial sheath of the somatic gonad and co-localized with actin filaments. Reference: Ono S & Ono K. J Biol Chem. (2020) 295(34):12014-12027. PMID: 32554465
Proper citation: RRID:WB-STRAIN:WBStrain00062907 Copy
http://www.wormbase.org/db/get?name=WBStrain00062905
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006782(unc-46)|WBGene00017430(bcl-11)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006782(unc-46), WBGene00017430(bcl-11)
Availability: unknown
Source References: EMPTY
Synonyms: bcl-11(cu10)/unc-46(e177) dpy-11(e224) V.
Notes: Made_by: Tomas Vilimas|"Pick wild-type to maintain. Heterozygotes are wild-type and should segregate wild-type heterozygotes, bcl-11 homozygotes (L1 larval arrest with starved appearance), and Dpy Unc homozygotes (Medium Dpy, Shrinker, poor backing). Maintain by picking wild-type and scoring for proper segregation of progeny. bcl-11 homozygotes have weak pharyngeal muscle contractions and pharyngeal lumen fails to open. cu10 is a 555 bp deletion (V:6360921..6361460). Predicted bcl-11 null allele. Reference: Vilimas, Tomas. (2004). Genes regulating ceh-22 and pharyngeal development of Caenorhabditis elegans.. University of Illinois at Chicago. Thesis. https:"
Proper citation: RRID:WB-STRAIN:WBStrain00062905 Copy
http://www.wormbase.org/db/get?name=WBStrain00062906
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: cuEx467.
Notes: cuEx467 [ser-7::GFP + rol-6(su1006)]. Pick Rollers to maintain. Expresses GFP exclusively in the M4 pharyngeal neuron. Reference: Ray P, et al. Dev Neurobiol. 2008 68(4): p. 421-33. PMID 18161854.
Proper citation: RRID:WB-STRAIN:WBStrain00062906 Copy
http://www.wormbase.org/db/get?name=WBStrain00062862
Source Database: WormBase (WB)
Affected Genes: WBGene00000453(ceh-32)
Genomic Alteration: WBGene00000453(ceh-32)
Availability: unknown
Source References: EMPTY
Synonyms: Cbr-ceh-32(ot1431[Cbr-ceh-32::GFP]) V.
Notes: C-terminal GFP tag inserted before STOP codon of endogenous Cbr-ceh-32 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:|"Made_by: Itai Toker"
Proper citation: RRID:WB-STRAIN:WBStrain00062862 Copy
http://www.wormbase.org/db/get?name=WBStrain00062860
Source Database: WormBase (WB)
Affected Genes: WBGene00013665(hlh-32)
Genomic Alteration: WBGene00013665(hlh-32)
Availability: unknown
Source References: EMPTY
Synonyms: hlh-32(ot1347) IV.
Notes: CRISPR/Cas9-engineered 1691 bp deletion removing entire hlh-32 locus; similar to syb6773 deletion. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: Robert Aguilar"
Proper citation: RRID:WB-STRAIN:WBStrain00062860 Copy
http://www.wormbase.org/db/get?name=WBStrain00062900
Source Database: WormBase (WB)
Affected Genes: WBGene00000295(cat-1)
Genomic Alteration: WBGene00000295(cat-1)
Availability: unknown
Source References: EMPTY
Synonyms: Ctr-cat-1(ot1631[Ctr-cat-1::SL2::mScarlet3::H2B]) X.
Notes: Made_by: Itai Toker|"SL2::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-cat-1 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00062900 Copy
http://www.wormbase.org/db/get?name=WBStrain00062859
Source Database: WormBase (WB)
Affected Genes: WBGene00002090(ins-7)
Genomic Alteration: WBGene00002090(ins-7)
Availability: unknown
Source References: EMPTY
Synonyms: ins-7(ot1427) IV.
Notes: ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00062859 Copy
http://www.wormbase.org/db/get?name=WBStrain00062851
Source Database: WormBase (WB)
Affected Genes: WBGene00306126(cone-1)
Genomic Alteration: WBGene00306126(cone-1)
Availability: unknown
Source References: EMPTY
Synonyms: cone-1(ot1409[*syb5437[GFP::con-1]) III.
Notes: Made_by: Michael Cesar|"syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1409 is a deletion removing exons 1-7 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain."
Proper citation: RRID:WB-STRAIN:WBStrain00062851 Copy
http://www.wormbase.org/db/get?name=WBStrain00062852
Source Database: WormBase (WB)
Affected Genes: WBGene00306126(cone-1)
Genomic Alteration: WBGene00306126(cone-1)
Availability: unknown
Source References: EMPTY
Synonyms: cone-1(ot1410[*syb5437[GFP::con-1]) III.
Notes: Made_by: Michael Cesar|"syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1410 is a deletion removing exon 5 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain."
Proper citation: RRID:WB-STRAIN:WBStrain00062852 Copy
http://www.wormbase.org/db/get?name=WBStrain00062850
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs904 V.
Notes: otIs904 [ges-1p::ins-1::tagRFP-T::SL2::GFP::his-44::tbb-2 3 UTR + inx-6p18::tagRFP::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of INS-1 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00062850 Copy
http://www.wormbase.org/db/get?name=WBStrain00062856
Source Database: WormBase (WB)
Affected Genes: WBGene00003749(nlp-11)
Genomic Alteration: WBGene00003749(nlp-11)
Availability: unknown
Source References: EMPTY
Synonyms: Ctr-nlp-11(ot1422[Ctr-nlp-11::SL2::GFP::H2B]) II.
Notes: Made_by: Itai Toker|"SL2::GFP::H2B tag inserted before STOP codon of endogenous Ctr-nlp-11 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00062856 Copy
http://www.wormbase.org/db/get?name=WBStrain00062849
Source Database: WormBase (WB)
Affected Genes: WBGene00000679(col-105)|WBGene00001867(him-8)
Genomic Alteration: WBGene00000679(col-105), WBGene00001867(him-8)
Availability: unknown
Source References: EMPTY
Synonyms: col-105(syb6767[col-105::SL2::GFP::H2B]) him-8(e1489) IV.
Notes: Endogenous locus tagged with SL2::GFP::H2B at C-terminus using CRISPR/Cas9. The reporter is linked to him-8(e1489) in the background. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: Robert Aguilar"
Proper citation: RRID:WB-STRAIN:WBStrain00062849 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.