Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
mirSi34 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062768 | Caenorhabditis elegans | mirSi34 II; unc-119(ed3) III. | Made_by: Neus Sanfeliu Cerdan|"mirSi34 [myo-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in body wall muscles. Combine with CRE driven by a promoter expressed in desired muscle cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00062768 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||
|
mirSi16 II; mirIs76; mirEx69. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062765 | Caenorhabditis elegans | mirSi16 II; mirIs76; mirEx69. | mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs76 [sra-6p::ChRmine::wrmScarlet::let-858 3UTR + sra-6p::TeNL]. mirEx69 [gpa:14p::CRE + unc-122p::mCherry]. Mantain by picking animals with mCherry+ coelomycetes. Blue in flp-18 expressing neurons. Expression of ChRmine, wrmScarlet and calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ. Expression of ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651. | WB-STRAIN:WBStrain00062765 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||||
|
mirSi16 II; unc-119(ed3) III; mirIs110 V; mirIs107. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062758 | Caenorhabditis elegans | mirSi16 II; unc-119(ed3) III; mirIs110 V; mirIs107. | mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs110 [odr-7p::TeNL + unc-122p::GFP *oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] V. mirIs107 [gpa:14p::CRE + npr-9p::ChR-HRDC::YFP::SL2::jRGECO1a + rps-0p::hygroR]. Blue fluorescence in flp-18 expressing neurons. Green coelomycetes segregates with calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in AWA. ChR2-HRDC and jRGECO1a in AVA (instead of BFP) and ChR2-HRDC::YFP and jRGECO1a in AIB. HygroR. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00062758 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:20 | 0 | ||||
|
mirSi16 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062759 | Caenorhabditis elegans | mirSi16 II; unc-119(ed3) III. | mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00062759 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||
|
unc-119(ed3) III; qbcSi12 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062750 | Caenorhabditis elegans | unc-119(ed3) III; qbcSi12 IV. | qbcSi112 [elt-2p::GFP::his-58::3XmiR-228(mut)::tbb-2 3UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00062750 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||
|
unc-119(ed3) III; qbcSi11 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062751 | Caenorhabditis elegans | unc-119(ed3) III; qbcSi11 IV. | qbcSi11 [elt-1p::GFP::his-58::3XmiR-228::tbb-2 3UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00062751 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||
|
bus-17(br2) X; mirIs92. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062756 | Caenorhabditis elegans | bus-17(br2) X; mirIs92. | mirIs92 [daf-16p::daf-16::GcNL::let-858 3'UTR + myo-2p::mCherry]. bus-17(br2) has defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. daf-16 translational reporter with green non-calcium sensitive nanolantern (GCNL). Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346. | WBGene00044630(bus-17) | WBGene00044630(bus-17) | WB-STRAIN:WBStrain00062756 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||
|
nmy-1(mc90[nmy-1::gfp]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062754 | Caenorhabditis elegans | nmy-1(mc90[nmy-1::gfp]) X. | Maintain at 15C. nmy-1(mc90) allele induces almost complete sterility at 25C. mc90 is a CRISPR-engineered mutation in nmy-1 at the position corresponding to the allele nmy-2(ne3409) changing NMY-2 Leucine-981 to Proline, which is conserved among nonmuscle myosins. mc90 was introduced in parental strain ML2540, which carries a GFP-tag in the endogenous nmy-1 locus. Reference: Molnar K, et al. Genetics. 2024 Sep 4;228(1):iyae109. doi: 10.1093/genetics/iyae109. PMID: 39053622. | WBGene00003776(nmy-1) | WBGene00003776(nmy-1) | WB-STRAIN:WBStrain00062754 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||
|
nmy-2(ne3409) I; nmy-1(mc90[nmy-1::gfp]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062755 | Caenorhabditis elegans | nmy-2(ne3409) I; nmy-1(mc90[nmy-1::gfp]) X. | Maintain at 15C. nmy-2(ne3409) allele induces embryonic lethality (cytokinesis defective) at 25C. nmy-1(mc90) allele induces almost complete sterility at 25C. mc90 is a CRISPR-engineered mutation in nmy-1 at the position corresponding to the allele nmy-2(ne3409) changing NMY-2 Leucine-981 to Proline, which is conserved among nonmuscle myosins. mc90 was introduced in parental strain ML2540, which carries a GFP-tag in the endogenous nmy-1 locus. Reference: Molnar K, et al. Genetics. 2024 Sep 4;228(1):iyae109. doi: 10.1093/genetics/iyae109. PMID: 39053622. | WBGene00003776(nmy-1)|WBGene00003777(nmy-2) | WBGene00003776(nmy-1), WBGene00003777(nmy-2) | WB-STRAIN:WBStrain00062755 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||
|
unc-119(ed3) III; qbcSi10 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062749 | Caenorhabditis elegans | unc-119(ed3) III; qbcSi10 IV. | qbcSi10 [mex-5p::GFP::his-58::3XmiR-228(mut)::tbb-2 3UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00062749 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||
|
eps-8(cp441[eps-8::mNG-C1]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062747 | Caenorhabditis elegans | eps-8(cp441[eps-8::mNG-C1]) IV. | Made_by: Pu Zhang|"mNG reporter inserted into endogenous eps-8 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.." | WBGene00001330(eps-8) | WBGene00001330(eps-8) | WB-STRAIN:WBStrain00062747 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||
|
src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062741 | Caenorhabditis elegans | src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. | juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https: | WBGene00001067(dpy-5)|WBGene00005077(src-1)|WBGene00006753(unc-14) | WBGene00001067(dpy-5), WBGene00005077(src-1), WBGene00006753(unc-14) | WB-STRAIN:WBStrain00062741 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||
|
Propanagrolaimus sp. wild isolate. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062740 | Propanagrolaimus sp. | Propanagrolaimus sp. wild isolate. | Propanagrolaimus sp. wild isolate. Can be maintained and frozen using C. elegans conditions. Reference: Schiffer PH, et al. Dev Genes Evol. 2014 Jun;224(3):183-8. doi: 10.1007/s00427-014-0471-2. PMID: 24849338. | WB-STRAIN:WBStrain00062740 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:18 | 0 | ||||||
|
unc-94b(cp438[mNG-C1::unc-94b]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062744 | Caenorhabditis elegans | unc-94b(cp438[mNG-C1::unc-94b]) I. | Made_by: Pu Zhang|"mNG reporter inserted into endogenous unc-94b locus, specifically tagging the UNC-94B isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566." | WBGene00006823(unc-94) | WBGene00006823(unc-94) | WB-STRAIN:WBStrain00062744 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||
|
ceh-38(tm321) II; ceh-44(ot1015[ceh-44::gfp]) III; ceh-48(tm6112) IV; otDf1 X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062837 | Caenorhabditis elegans | ceh-38(tm321) II; ceh-44(ot1015[ceh-44::gfp]) III; ceh-48(tm6112) IV; otDf1 X. | Made_by: Michael Cesar|"ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. CUT Quintuple-mutant background. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain." | WBGene00000459(ceh-38)|WBGene00000464(ceh-44)|WBGene00015934(ceh-48) | WBGene00000459(ceh-38), WBGene00000464(ceh-44), WBGene00015934(ceh-48) | WB-STRAIN:WBStrain00062837 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:20 | 0 | ||||
|
aex-1(ot1357) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062838 | Caenorhabditis elegans | aex-1(ot1357) I. | ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: | WBGene00000084(aex-1) | WBGene00000084(aex-1) | WB-STRAIN:WBStrain00062838 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:21 | 0 | ||||
|
ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062835 | Caenorhabditis elegans | ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I. | ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: | WBGene00000912(daf-16)|WBGene00002101(ins-18) | WBGene00000912(daf-16), WBGene00002101(ins-18) | WB-STRAIN:WBStrain00062835 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:20 | 0 | ||||
|
qySi205 I; sec-16A.1(qy234[mNG::sec16A.1]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062797 | Caenorhabditis elegans | qySi205 I; sec-16A.1(qy234[mNG::sec16A.1]) III. | Made_by: Sherwood Lab|"qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and sec-16A.1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804." | WB-STRAIN:WBStrain00062797 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 | ||||||
|
cdh-9(ot1247) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062830 | Caenorhabditis elegans | cdh-9(ot1247) X. | CRISPR/Cas9 engineered deletion of full cdh-9 locus.|"Made_by: Maryam Majeed" | WBGene00000401(cdh-9) | WBGene00000401(cdh-9) | WB-STRAIN:WBStrain00062830 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:21 | 0 | ||||
|
qySi229 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062795 | Caenorhabditis elegans | qySi229 I. | Made_by: Sherwood Lab|"qySi229 [cdh-3p::lmp-1::mNG] I. MosSCI single copy insertion. Anchor cell specific expression of lysosomal protein lmp-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804." | WB-STRAIN:WBStrain00062795 | WormBase (WB) | WB | unknown | WormBase | 2026-11-07 10:18:19 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
