Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ACI/N-j Resource Report Resource Website |
RRID:RGD_728187 | Rattus norvegicus | Strain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. | 728187 | congenic | Rat Genome Database (RGD) | RGD | Extinct | 728187 | 2026-09-05 06:52:11 | 0 | |||||
|
DA.F344-(D10Arb20-D10Arb22)/Arb Resource Report Resource Website |
RRID:RGD_631282 | Rattus norvegicus | This speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background. | 631282 | congenic | Rat Genome Database (RGD) | RGD | Extinct | 631282 | 2026-09-05 06:52:12 | 0 | |||||
|
ACI.BN-(D5Mgh17-D5Rat205)/Shul Resource Report Resource Website |
RRID:RGD_1566445 | Rattus norvegicus | This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background | 1566445 | congenic | Rat Genome Database (RGD) | RGD | Extinct | 1566445 | 2026-09-05 06:52:14 | 0 | |||||
|
LEW.1AV1 Resource Report Resource Website |
RRID:RGD_737657 | Rattus norvegicus | Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1av1 haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region. | 737657 | congenic | Rat Genome Database (RGD) | RGD | Extinct | 737657 | 2026-09-05 06:52:16 | 0 | |||||
|
RHA/N-j Resource Report Resource Website |
RRID:RGD_728196 | Rattus norvegicus | Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics. | 728196 | congenic | Rat Genome Database (RGD) | RGD | Extinct | 728196 | 2026-09-05 06:52:16 | 0 | |||||
|
SS-Apoeem8Mcwi Resource Report Resource Website |
RRID:RGD_5131920 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2. | 5131920 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5131920 | 2026-09-05 06:52:27 | 0 | |||||
|
SS-Apoeem7Mcwi Resource Report Resource Website |
RRID:RGD_5131921 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2. | 5131921 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5131921 | 2026-09-05 06:52:27 | 0 | |||||
|
FHH.BN(D1Rat265-D1Rat76)/Mcwi Resource Report Resource Website |
RRID:RGD_5490515 | Rattus norvegicus | desired segments from BN were introgressed in FHH background | 5490515 | congenic | Rat Genome Database (RGD) | RGD | Extinct | 5490515 | 2026-09-05 06:52:28 | 0 | |||||
|
SS-Stk39em2Mcwi Resource Report Resource Website |
RRID:RGD_5509996 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence AACAGCCATTGAattagCAACGGGAGCAGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 7. | 5509996 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5509996 | 2026-09-05 06:52:28 | 0 | |||||
|
SS-Gucy1a3em1Mcwi Resource Report Resource Website |
RRID:RGD_5508356 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CCCTGCTTCTCCCCGGTAtcattAAAGCGGCTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 5. | 5508356 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5508356 | 2026-09-05 06:52:29 | 0 | |||||
|
SS-Tfdp2em5Mcwi Resource Report Resource Website |
RRID:RGD_5508366 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6. | 5508366 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5508366 | 2026-09-05 06:52:29 | 0 | |||||
|
SS-Nckap5em1Mcwi Resource Report Resource Website |
RRID:RGD_4139879 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6. | 4139879 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 4139879 | 2026-09-05 06:52:26 | 0 | |||||
|
SS-Mylipem3Mcwi Resource Report Resource Website |
RRID:RGD_5508371 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1. | 5508371 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5508371 | 2026-09-05 06:52:29 | 0 | |||||
|
SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5em4Mcwi Resource Report Resource Website |
RRID:RGD_5509997 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. | 5509997 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5509997 | 2026-09-05 06:52:28 | 0 | |||||
|
SS-Chr 5BN-Cyp4a2em1Mcwi Resource Report Resource Website |
RRID:RGD_5687974 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2. | 5687974 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5687974 | 2026-09-05 06:52:28 | 0 | |||||
|
SS-Apoeem8Mcwi+/+ Resource Report Resource Website |
RRID:RGD_5687992 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5687992 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5687992 | 2026-09-05 06:52:29 | 0 | |||||
|
SS-Apoeem7Mcwi-/- Resource Report Resource Website |
RRID:RGD_5687987 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5687987 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5687987 | 2026-09-05 06:52:29 | 0 | |||||
|
SS-Chr 5BN-Cyp4a2em1Mcwi-/+ Resource Report Resource Website |
RRID:RGD_5688006 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5688006 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5688006 | 2026-09-05 06:52:29 | 0 | |||||
|
SS-Chr 5BN-Cyp4a2em1Mcwi+/+ Resource Report Resource Website |
RRID:RGD_5688002 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5688002 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5688002 | 2026-09-05 06:52:29 | 0 | |||||
|
BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi-Il1r1em1Mcwi Resource Report Resource Website |
RRID:RGD_6893437 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5. | 6893437 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 6893437 | 2026-09-05 06:52:30 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.