Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 190 showing 3781 ~ 3800 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00027516

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027516

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003036(lin-53)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003036(lin-53)
Availability: available
Source References: PMID:31397537
Synonyms: lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:MT15107, CGC_MT15107
Notes: Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027516 Copy   

    • RRID:WB-STRAIN:WBStrain00027597

http://www.wormbase.org/db/get?name=WBStrain00027597

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nIs363 X.
Alternate IDs: WB-STRAIN:MT19110, CGC_MT19110
Notes: Mutagen:Gamma radiation|"nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27"|"nIs363 [D2096.6 (1.7kb UP)::pes-10::4xNLS::GFP + lin-15AB(+)]. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27 [NOTE (Aug 2019): the nIs363 trasngene in this strain was previously described as nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X.]"

Proper citation: RRID:WB-STRAIN:WBStrain00027597 Copy   

    • RRID:WB-STRAIN:WBStrain00027599

http://www.wormbase.org/db/get?name=WBStrain00027599

Source Database: WormBase (WB)
Affected Genes: WBGene00012735(sptf-3)
Genomic Alteration: WBGene00012735(sptf-3)
Availability: available
Source References: EMPTY
Synonyms: sptf-3(n4850) I; nIs283 X.
Alternate IDs: WB-STRAIN:MT19372, CGC_MT19372
Notes: nIs283 [gcy-10p::4xNLS::GFP + lin-15(+)]. gcy-10p::4xNLS::GFP is expressed in I1 neurons. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358.|"nIs283 [gcy-10p::GFP + lin-15(+)]. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358."

Proper citation: RRID:WB-STRAIN:WBStrain00027599 Copy   

    • RRID:WB-STRAIN:WBStrain00027512

http://www.wormbase.org/db/get?name=WBStrain00027512

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006324(sup-17)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006324(sup-17), WBGene00006765(unc-29)
Availability: available
Source References: EMPTY
Synonyms: sup-17(n1315) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:MT15081, CGC_MT15081
Notes: Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1315 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Proper citation: RRID:WB-STRAIN:WBStrain00027512 Copy   

    • RRID:WB-STRAIN:WBStrain00027593

http://www.wormbase.org/db/get?name=WBStrain00027593

Source Database: WormBase (WB)
Affected Genes: WBGene00003286(mir-58.1)
Genomic Alteration: WBGene00003286(mir-58.1)
Availability: available
Source References: EMPTY
Synonyms: mir-58.1(n4640) IV; nDf54 X.
Alternate IDs: WB-STRAIN:MT18410, CGC_MT18410
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."

Proper citation: RRID:WB-STRAIN:WBStrain00027593 Copy   

    • RRID:WB-STRAIN:WBStrain00027594

http://www.wormbase.org/db/get?name=WBStrain00027594

Source Database: WormBase (WB)
Affected Genes: WBGene00013808(sfa-1)
Genomic Alteration: WBGene00013808(sfa-1)
Availability: available
Source References: EMPTY
Synonyms: sfa-1(n5223) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:MT18690, CGC_MT18690
Notes: Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.

Proper citation: RRID:WB-STRAIN:WBStrain00027594 Copy   

    • RRID:WB-STRAIN:WBStrain00027591

http://www.wormbase.org/db/get?name=WBStrain00027591

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nIs289 X.
Alternate IDs: WB-STRAIN:MT18145, CGC_MT18145
Notes: Mutagen:Gamma radiation|"nIs289 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50."

Proper citation: RRID:WB-STRAIN:WBStrain00027591 Copy   

    • RRID:WB-STRAIN:WBStrain00027592

http://www.wormbase.org/db/get?name=WBStrain00027592

Source Database: WormBase (WB)
Affected Genes: WBGene00003286(mir-58.1)
Genomic Alteration: WBGene00003286(mir-58.1)
Availability: available
Source References: EMPTY
Synonyms: nDf53 III; mir-58.1(n4640) IV.
Alternate IDs: WB-STRAIN:MT18409, CGC_MT18409
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."

Proper citation: RRID:WB-STRAIN:WBStrain00027592 Copy   

    • RRID:WB-STRAIN:WBStrain00027506

http://www.wormbase.org/db/get?name=WBStrain00027506

Source Database: WormBase (WB)
Affected Genes: WBGene00003311(mir-83)
Genomic Alteration: WBGene00003311(mir-83)
Availability: available
Source References: EMPTY
Synonyms: mir-83(n4638) IV.
Alternate IDs: WB-STRAIN:MT15022, CGC_MT15022
Notes: Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027506 Copy   

    • RRID:WB-STRAIN:WBStrain00027509

http://www.wormbase.org/db/get?name=WBStrain00027509

Source Database: WormBase (WB)
Affected Genes: WBGene00003362(mir-269)
Genomic Alteration: WBGene00003362(mir-269)
Availability: available
Source References: EMPTY
Synonyms: mir-269(n4641) IV.
Alternate IDs: WB-STRAIN:MT15025, CGC_MT15025
Notes: Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027509 Copy   

    • RRID:WB-STRAIN:WBStrain00027503

http://www.wormbase.org/db/get?name=WBStrain00027503

Source Database: WormBase (WB)
Availability: available
Source References: PMID:38594249
Synonyms: nDf60 V.
Alternate IDs: WB-STRAIN:MT15019, CGC_MT15019
Notes: Made_by: Horvitz Lab|"mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027503 Copy   

    • RRID:WB-STRAIN:WBStrain00027504

http://www.wormbase.org/db/get?name=WBStrain00027504

Source Database: WormBase (WB)
Affected Genes: WBGene00003340(mir-246)
Genomic Alteration: WBGene00003340(mir-246)
Availability: available
Source References: PMID:31307392
Synonyms: mir-246(n4636) IV.
Alternate IDs: WB-STRAIN:MT15020, CGC_MT15020
Notes: Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027504 Copy   

    • RRID:WB-STRAIN:WBStrain00027505

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027505

Source Database: WormBase (WB)
Affected Genes: WBGene00003306(mir-78)
Genomic Alteration: WBGene00003306(mir-78)
Availability: available
Source References: EMPTY
Synonyms: mir-78(n4637) IV.
Alternate IDs: WB-STRAIN:MT15021, CGC_MT15021
Notes: Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027505 Copy   

    • RRID:WB-STRAIN:WBStrain00027586

http://www.wormbase.org/db/get?name=WBStrain00027586

Source Database: WormBase (WB)
Affected Genes: WBGene00002993(lin-4)|WBGene00003330(mir-237)
Genomic Alteration: WBGene00002993(lin-4), WBGene00003330(mir-237)
Availability: available
Source References: EMPTY
Synonyms: lin-4(e912) II; mir-237(n4296) X.
Alternate IDs: WB-STRAIN:MT18023, CGC_MT18023
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."

Proper citation: RRID:WB-STRAIN:WBStrain00027586 Copy   

    • RRID:WB-STRAIN:WBStrain00027588

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027588

Source Database: WormBase (WB)
Affected Genes: WBGene00003334(mir-240)|WBGene00045343(mir-786)
Genomic Alteration: WBGene00003334(mir-240), WBGene00045343(mir-786)
Availability: available
Source References: EMPTY
Synonyms: mir-240&mir-786(n4541) X.
Alternate IDs: WB-STRAIN:MT18043, CGC_MT18043
Notes: Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"

Proper citation: RRID:WB-STRAIN:WBStrain00027588 Copy   

    • RRID:WB-STRAIN:WBStrain00027656

http://www.wormbase.org/db/get?name=WBStrain00027656

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:30078564, PMID:33593818, PMID:33820969, PMID:38547054, PMID:38564369
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:MY10, CGC_MY10
Notes: Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."|"Wild-type natural isolate"

Proper citation: RRID:WB-STRAIN:WBStrain00027656 Copy   

    • RRID:WB-STRAIN:WBStrain00027650

http://www.wormbase.org/db/get?name=WBStrain00027650

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY4, CGC_MY4
Notes: Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.

Proper citation: RRID:WB-STRAIN:WBStrain00027650 Copy   

    • RRID:WB-STRAIN:WBStrain00027649

http://www.wormbase.org/db/get?name=WBStrain00027649

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY3, CGC_MY3
Notes: Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00027649 Copy   

    • RRID:WB-STRAIN:WBStrain00027645

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027645

Source Database: WormBase (WB)
Affected Genes: WBGene00016935(ifta-1)
Genomic Alteration: WBGene00016935(ifta-1)
Availability: available
Source References: PMID:38302462
Synonyms: ifta-1(nx61) X.
Alternate IDs: WB-STRAIN:MX124, CGC_MX124
Notes: Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.

Proper citation: RRID:WB-STRAIN:WBStrain00027645 Copy   

    • RRID:WB-STRAIN:WBStrain00027647

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027647

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:31422888, PMID:33820969, PMID:34622777, PMID:38564369, PMID:38865452
Synonyms: wild
Alternate IDs: WB-STRAIN:MY1, CGC_MY1
Notes: Natural isolate; obtained in April 2002 from compost heap in Lingen, Emsland, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU1.

Proper citation: RRID:WB-STRAIN:WBStrain00027647 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch