Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MT16113 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027542 | Caenorhabditis elegans | nDf66 III/+. | Made_by: Ezequiel Alvarez-Saa|"Unbalanced heterozygous stock! Needs to be followed by PCR." | WB-STRAIN:WBStrain00027542 | WormBase (WB) | WB | available | WB-STRAIN:MT16113, CGC_MT16113 | 2026-09-12 11:15:32 | 0 | |||||
|
MT16133 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027543 | Caenorhabditis elegans | set-24(n4909) II. | Reference: Development 134(16):2991-9 (2007). | WBGene00012845(set-24) | WBGene00012845(set-24) | WB-STRAIN:WBStrain00027543 | WormBase (WB) | WB | available | WB-STRAIN:MT16133, CGC_MT16133 | 2026-09-12 11:15:32 | 0 | |||
|
MT17810 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027582 | Caenorhabditis elegans | mir-1(n4102) I. | Deletion breakpoints are: CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP" | WBGene00003260(mir-1) | WBGene00003260(mir-1) | WB-STRAIN:WBStrain00027582 | WormBase (WB) | WB | available | PMID:38555276 | WB-STRAIN:MT17810, CGC_MT17810 | 2026-09-12 11:15:32 | 0 | ||
|
MT17848 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027583 | Caenorhabditis elegans | mir-2(n4108) I; nDf49 II; nDf59 V; mir-247(n4505) X. | Made_by: Ezequiel Alvarez-Saa|"mir-2 family and most of mir-44 family are removed in this strain (mir-45 is present). Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." | WBGene00003261(mir-2)|WBGene00003341(mir-247) | WBGene00003261(mir-2), WBGene00003341(mir-247) | WB-STRAIN:WBStrain00027583 | WormBase (WB) | WB | available | WB-STRAIN:MT17848, CGC_MT17848 | 2026-09-12 11:15:32 | 0 | |||
|
MT17997 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027584 | Caenorhabditis elegans | mir-235(n4504) I. | Deletion breakpoints are: ATCGGCCATCAGAACAGTGCAAGAAAT / TTGAGAAATATG...ATCCACAGGTGGT / GTCATCTGAAGAAAGGACACACATACATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members" | WBGene00003328(mir-235) | WBGene00003328(mir-235) | WB-STRAIN:WBStrain00027584 | WormBase (WB) | WB | available | PMID:38594249 | WB-STRAIN:MT17997, CGC_MT17997 | 2026-09-12 11:15:32 | 0 | ||
|
MT17676 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027581 | Caenorhabditis elegans | mir-45(n4280) II; nDf59 V; mir-247(n4505) X. | Made_by: Ezequiel Alvarez-Saa|"nDf59 removes mir-61 and mir-250. mir-6, mir-247, and mir-45 are related in sequence. Reference: Curr Bio (2010) 20:367-73." | WBGene00003273(mir-45)|WBGene00003341(mir-247) | WBGene00003273(mir-45), WBGene00003341(mir-247) | WB-STRAIN:WBStrain00027581 | WormBase (WB) | WB | available | WB-STRAIN:MT17676, CGC_MT17676 | 2026-09-12 11:15:32 | 0 | |||
|
MT17463 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027579 | Caenorhabditis elegans | set-25(n5021) III. | Contained background Let mutation that was lost during outcrossing. Reference: Development 134(16):2991-9 (2007).|"Made_by: Erik Anderson" | WBGene00012802(set-25) | WBGene00012802(set-25) | WB-STRAIN:WBStrain00027579 | WormBase (WB) | WB | available | PMID:33594200 | WB-STRAIN:MT17463, CGC_MT17463 | 2026-09-12 11:15:32 | 2 | ||
|
MT17429 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027575 | Caenorhabditis elegans | nDf67 IV. | Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." | WB-STRAIN:WBStrain00027575 | WormBase (WB) | WB | available | WB-STRAIN:MT17429, CGC_MT17429 | 2026-09-12 11:15:32 | 0 | |||||
|
MT17445 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027577 | Caenorhabditis elegans | mir-62(n4539) X. | 993 bp deletion covering bases 11371-12364 of T07C5. Deletion covers mir-62 (11867-11890) and part of the predicted gene T07C5.6. | WBGene00003290(mir-62) | WBGene00003290(mir-62) | WB-STRAIN:WBStrain00027577 | WormBase (WB) | WB | available | WB-STRAIN:MT17445, CGC_MT17445 | 2026-09-12 11:15:32 | 0 | |||
|
MT17446 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027578 | Caenorhabditis elegans | mir-53(n4113) mir-52(n4100) IV; nDf58 X. | Made_by: Ezequiel Alvarez-Saa|"Slow growing. Some larval and adult lethality. Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."|"Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." | WBGene00003280(mir-52)|WBGene00003281(mir-53) | WBGene00003280(mir-52), WBGene00003281(mir-53) | WB-STRAIN:WBStrain00027578 | WormBase (WB) | WB | available | WB-STRAIN:MT17446, CGC_MT17446 | 2026-09-12 11:15:32 | 0 | |||
|
MT17137 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027571 | Caenorhabditis elegans | mir-51(n4473) IV; nDf58 X. | Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." | WBGene00003279(mir-51) | WBGene00003279(mir-51) | WB-STRAIN:WBStrain00027571 | WormBase (WB) | WB | available | WB-STRAIN:MT17137, CGC_MT17137 | 2026-09-12 11:15:32 | 0 | |||
|
MT17143 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027572 | Caenorhabditis elegans | nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X. | Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73.|"Made_by: Ezequiel Alvarez-Saa" | WBGene00003280(mir-52) | WBGene00003280(mir-52) | WB-STRAIN:WBStrain00027572 | WormBase (WB) | WB | available | WB-STRAIN:MT17143, CGC_MT17143 | 2026-09-12 11:15:32 | 0 | |||
|
MT17428 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027574 | Caenorhabditis elegans | mir-72(n4130) II; nDf47 X. | Made_by: Ezequiel Alvarez-Saa|"Reference: Curr Bio (2010) 20:367-73." | WBGene00003300(mir-72) | WBGene00003300(mir-72) | WB-STRAIN:WBStrain00027574 | WormBase (WB) | WB | available | WB-STRAIN:MT17428, CGC_MT17428 | 2026-09-12 11:15:32 | 0 | |||
|
MT17136 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027570 | Caenorhabditis elegans | nDf67 IV; nDf58 X. | Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." | WB-STRAIN:WBStrain00027570 | WormBase (WB) | WB | available | WB-STRAIN:MT17136, CGC_MT17136 | 2026-09-12 11:15:32 | 0 | |||||
|
MT19635 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027601 | Caenorhabditis elegans | lin-15B&lin-15A(n765) X; nIs407. | Mutagen:Gamma|"nIs407 [hlh-2::GFP + lin-15(+)]. Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27." | WBGene00023497(lin-15B)|WBGene00023498(lin-15A) | WBGene00023497(lin-15B), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00027601 | WormBase (WB) | WB | available | WB-STRAIN:MT19635, CGC_MT19635 | 2026-09-12 11:15:32 | 0 | |||
|
MT16696 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027564 | Caenorhabditis elegans | mir-244(n4367) I. | Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" | WBGene00003338(mir-244) | WBGene00003338(mir-244) | WB-STRAIN:WBStrain00027564 | WormBase (WB) | WB | available | WB-STRAIN:MT16696, CGC_MT16696 | 2026-09-12 11:15:32 | 0 | |||
|
MT16762 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027565 | Caenorhabditis elegans | mir-256(n4471) V. | Complete deletion allele of mir-256 from bases 5826-6853 on T07H8. This mutation likely has a polar effect on mec-1, which starts at 6924 on T07H8 (the deletion covers putative promoter elements). | WBGene00003350(mir-256) | WBGene00003350(mir-256) | WB-STRAIN:WBStrain00027565 | WormBase (WB) | WB | available | WB-STRAIN:MT16762, CGC_MT16762 | 2026-09-12 11:15:32 | 0 | |||
|
MT16846 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027566 | Caenorhabditis elegans | csp-1(n4967) II. | Mutagen:UV/TMP|"n4967 is a 769 bp deletion that removes the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341." | WBGene00000819(csp-1) | WBGene00000819(csp-1) | WB-STRAIN:WBStrain00027566 | WormBase (WB) | WB | available | WB-STRAIN:MT16846, CGC_MT16846 | 2026-09-12 11:15:32 | 0 | |||
|
MT19454 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027600 | Caenorhabditis elegans | nIs396 V. | Mutagen:Gamma radiation|"nIs396 [sams-5 3'::4xNLS-GFP + lin-15(+)] V. GFP expression in MI. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27" | WB-STRAIN:WBStrain00027600 | WormBase (WB) | WB | available | WB-STRAIN:MT19454, CGC_MT19454 | 2026-09-12 11:15:32 | 0 | |||||
|
MT15312 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027518 | Caenorhabditis elegans | nDf62 X. | Made_by: Horvitz Lab|"mir-239a and mir-239b are deleted in nDf62. Deletion breakpoints are:GAGTTTTTAACAGTTTCG / CCACTGGCGCTACTC...AATTGTCGACCAAAAAAAT / CTTGCTATAGTTAAATATTCAATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"mir-239a and mir-239b are deleted in nDf62. Deletion breakpoints are:GAGTTTTTAACAGTTTCG / CCACTGGCGCTACTC...AATTGTCGACCAAAAAAAT / CTTGCTATAGTTAAATATTCAATTT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects." | WB-STRAIN:WBStrain00027518 | WormBase (WB) | WB | available | WB-STRAIN:MT15312, CGC_MT15312 | 2026-09-12 11:15:31 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
