Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00027542
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nDf66 III/+.
Alternate IDs: WB-STRAIN:MT16113, CGC_MT16113
Notes: Made_by: Ezequiel Alvarez-Saa|"Unbalanced heterozygous stock! Needs to be followed by PCR."
Proper citation: RRID:WB-STRAIN:WBStrain00027542 Copy
http://www.wormbase.org/db/get?name=WBStrain00027543
Source Database: WormBase (WB)
Affected Genes: WBGene00012845(set-24)
Genomic Alteration: WBGene00012845(set-24)
Availability: available
Source References: EMPTY
Synonyms: set-24(n4909) II.
Alternate IDs: WB-STRAIN:MT16133, CGC_MT16133
Notes: Reference: Development 134(16):2991-9 (2007).
Proper citation: RRID:WB-STRAIN:WBStrain00027543 Copy
http://www.wormbase.org/db/get?name=WBStrain00027582
Source Database: WormBase (WB)
Affected Genes: WBGene00003260(mir-1)
Genomic Alteration: WBGene00003260(mir-1)
Availability: available
Source References: PMID:38555276
Synonyms: mir-1(n4102) I.
Alternate IDs: WB-STRAIN:MT17810, CGC_MT17810
Notes: Deletion breakpoints are: CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027582 Copy
http://www.wormbase.org/db/get?name=WBStrain00027583
Source Database: WormBase (WB)
Affected Genes: WBGene00003261(mir-2)|WBGene00003341(mir-247)
Genomic Alteration: WBGene00003261(mir-2), WBGene00003341(mir-247)
Availability: available
Source References: EMPTY
Synonyms: mir-2(n4108) I; nDf49 II; nDf59 V; mir-247(n4505) X.
Alternate IDs: WB-STRAIN:MT17848, CGC_MT17848
Notes: Made_by: Ezequiel Alvarez-Saa|"mir-2 family and most of mir-44 family are removed in this strain (mir-45 is present). Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027583 Copy
http://www.wormbase.org/db/get?name=WBStrain00027584
Source Database: WormBase (WB)
Affected Genes: WBGene00003328(mir-235)
Genomic Alteration: WBGene00003328(mir-235)
Availability: available
Source References: PMID:38594249
Synonyms: mir-235(n4504) I.
Alternate IDs: WB-STRAIN:MT17997, CGC_MT17997
Notes: Deletion breakpoints are: ATCGGCCATCAGAACAGTGCAAGAAAT / TTGAGAAATATG...ATCCACAGGTGGT / GTCATCTGAAGAAAGGACACACATACATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"
Proper citation: RRID:WB-STRAIN:WBStrain00027584 Copy
http://www.wormbase.org/db/get?name=WBStrain00027581
Source Database: WormBase (WB)
Affected Genes: WBGene00003273(mir-45)|WBGene00003341(mir-247)
Genomic Alteration: WBGene00003273(mir-45), WBGene00003341(mir-247)
Availability: available
Source References: EMPTY
Synonyms: mir-45(n4280) II; nDf59 V; mir-247(n4505) X.
Alternate IDs: WB-STRAIN:MT17676, CGC_MT17676
Notes: Made_by: Ezequiel Alvarez-Saa|"nDf59 removes mir-61 and mir-250. mir-6, mir-247, and mir-45 are related in sequence. Reference: Curr Bio (2010) 20:367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027581 Copy
http://www.wormbase.org/db/get?name=WBStrain00027579
Source Database: WormBase (WB)
Affected Genes: WBGene00012802(set-25)
Genomic Alteration: WBGene00012802(set-25)
Availability: available
Source References: PMID:33594200
Synonyms: set-25(n5021) III.
Alternate IDs: WB-STRAIN:MT17463, CGC_MT17463
Notes: Contained background Let mutation that was lost during outcrossing. Reference: Development 134(16):2991-9 (2007).|"Made_by: Erik Anderson"
Proper citation: RRID:WB-STRAIN:WBStrain00027579 Copy
http://www.wormbase.org/db/get?name=WBStrain00027575
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nDf67 IV.
Alternate IDs: WB-STRAIN:MT17429, CGC_MT17429
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027575 Copy
http://www.wormbase.org/db/get?name=WBStrain00027577
Source Database: WormBase (WB)
Affected Genes: WBGene00003290(mir-62)
Genomic Alteration: WBGene00003290(mir-62)
Availability: available
Source References: EMPTY
Synonyms: mir-62(n4539) X.
Alternate IDs: WB-STRAIN:MT17445, CGC_MT17445
Notes: 993 bp deletion covering bases 11371-12364 of T07C5. Deletion covers mir-62 (11867-11890) and part of the predicted gene T07C5.6.
Proper citation: RRID:WB-STRAIN:WBStrain00027577 Copy
http://www.wormbase.org/db/get?name=WBStrain00027578
Source Database: WormBase (WB)
Affected Genes: WBGene00003280(mir-52)|WBGene00003281(mir-53)
Genomic Alteration: WBGene00003280(mir-52), WBGene00003281(mir-53)
Availability: available
Source References: EMPTY
Synonyms: mir-53(n4113) mir-52(n4100) IV; nDf58 X.
Alternate IDs: WB-STRAIN:MT17446, CGC_MT17446
Notes: Made_by: Ezequiel Alvarez-Saa|"Slow growing. Some larval and adult lethality. Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."|"Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027578 Copy
http://www.wormbase.org/db/get?name=WBStrain00027571
Source Database: WormBase (WB)
Affected Genes: WBGene00003279(mir-51)
Genomic Alteration: WBGene00003279(mir-51)
Availability: available
Source References: EMPTY
Synonyms: mir-51(n4473) IV; nDf58 X.
Alternate IDs: WB-STRAIN:MT17137, CGC_MT17137
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027571 Copy
http://www.wormbase.org/db/get?name=WBStrain00027572
Source Database: WormBase (WB)
Affected Genes: WBGene00003280(mir-52)
Genomic Alteration: WBGene00003280(mir-52)
Availability: available
Source References: EMPTY
Synonyms: nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X.
Alternate IDs: WB-STRAIN:MT17143, CGC_MT17143
Notes: Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73.|"Made_by: Ezequiel Alvarez-Saa"
Proper citation: RRID:WB-STRAIN:WBStrain00027572 Copy
http://www.wormbase.org/db/get?name=WBStrain00027574
Source Database: WormBase (WB)
Affected Genes: WBGene00003300(mir-72)
Genomic Alteration: WBGene00003300(mir-72)
Availability: available
Source References: EMPTY
Synonyms: mir-72(n4130) II; nDf47 X.
Alternate IDs: WB-STRAIN:MT17428, CGC_MT17428
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Curr Bio (2010) 20:367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027574 Copy
http://www.wormbase.org/db/get?name=WBStrain00027570
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nDf67 IV; nDf58 X.
Alternate IDs: WB-STRAIN:MT17136, CGC_MT17136
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027570 Copy
http://www.wormbase.org/db/get?name=WBStrain00027601
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: lin-15B&lin-15A(n765) X; nIs407.
Alternate IDs: WB-STRAIN:MT19635, CGC_MT19635
Notes: Mutagen:Gamma|"nIs407 [hlh-2::GFP + lin-15(+)]. Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27."
Proper citation: RRID:WB-STRAIN:WBStrain00027601 Copy
http://www.wormbase.org/db/get?name=WBStrain00027564
Source Database: WormBase (WB)
Affected Genes: WBGene00003338(mir-244)
Genomic Alteration: WBGene00003338(mir-244)
Availability: available
Source References: EMPTY
Synonyms: mir-244(n4367) I.
Alternate IDs: WB-STRAIN:MT16696, CGC_MT16696
Notes: Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027564 Copy
http://www.wormbase.org/db/get?name=WBStrain00027565
Source Database: WormBase (WB)
Affected Genes: WBGene00003350(mir-256)
Genomic Alteration: WBGene00003350(mir-256)
Availability: available
Source References: EMPTY
Synonyms: mir-256(n4471) V.
Alternate IDs: WB-STRAIN:MT16762, CGC_MT16762
Notes: Complete deletion allele of mir-256 from bases 5826-6853 on T07H8. This mutation likely has a polar effect on mec-1, which starts at 6924 on T07H8 (the deletion covers putative promoter elements).
Proper citation: RRID:WB-STRAIN:WBStrain00027565 Copy
http://www.wormbase.org/db/get?name=WBStrain00027566
Source Database: WormBase (WB)
Affected Genes: WBGene00000819(csp-1)
Genomic Alteration: WBGene00000819(csp-1)
Availability: available
Source References: EMPTY
Synonyms: csp-1(n4967) II.
Alternate IDs: WB-STRAIN:MT16846, CGC_MT16846
Notes: Mutagen:UV/TMP|"n4967 is a 769 bp deletion that removes the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341."
Proper citation: RRID:WB-STRAIN:WBStrain00027566 Copy
http://www.wormbase.org/db/get?name=WBStrain00027600
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nIs396 V.
Alternate IDs: WB-STRAIN:MT19454, CGC_MT19454
Notes: Mutagen:Gamma radiation|"nIs396 [sams-5 3'::4xNLS-GFP + lin-15(+)] V. GFP expression in MI. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27"
Proper citation: RRID:WB-STRAIN:WBStrain00027600 Copy
http://www.wormbase.org/db/get?name=WBStrain00027518
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nDf62 X.
Alternate IDs: WB-STRAIN:MT15312, CGC_MT15312
Notes: Made_by: Horvitz Lab|"mir-239a and mir-239b are deleted in nDf62. Deletion breakpoints are:GAGTTTTTAACAGTTTCG / CCACTGGCGCTACTC...AATTGTCGACCAAAAAAAT / CTTGCTATAGTTAAATATTCAATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"mir-239a and mir-239b are deleted in nDf62. Deletion breakpoints are:GAGTTTTTAACAGTTTCG / CCACTGGCGCTACTC...AATTGTCGACCAAAAAAAT / CTTGCTATAGTTAAATATTCAATTT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."
Proper citation: RRID:WB-STRAIN:WBStrain00027518 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.