Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 16 showing 301 ~ 320 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00062599

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphEx3.
Notes: fphEx3 [aak-2Ap::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2c isoform expressed from the aak-2a promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

Proper citation: RRID:WB-STRAIN:WBStrain00062599 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062632

Source Database: WormBase (WB)
Affected Genes: WBGene00004398(rol-8)
Genomic Alteration: WBGene00004398(rol-8)
Availability: unknown
Source References: EMPTY
Synonyms: rol-8(wrd230[rol-8mNG::3xFLAG]) II.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous rol-8 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Proper citation: RRID:WB-STRAIN:WBStrain00062632 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062596

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphIs1.
Notes: fphIs1 [aak-2Ap::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed with its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

Proper citation: RRID:WB-STRAIN:WBStrain00062596 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062597

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00020142(aak-2)
Genomic Alteration: WBGene00006843(unc-119), WBGene00020142(aak-2)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; aak-2(ok524) X; fphEx1.
Notes: fphEx1 [aak-2Cp::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2C isoform expressed from its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

Proper citation: RRID:WB-STRAIN:WBStrain00062597 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062630

Source Database: WormBase (WB)
Affected Genes: WBGene00001066(dpy-4)
Genomic Alteration: WBGene00001066(dpy-4)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-4(wrd228[dpy-4::mNG::3xFLAG]) IV.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dpy-4 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Proper citation: RRID:WB-STRAIN:WBStrain00062630 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062635

Source Database: WormBase (WB)
Affected Genes: WBGene00009983(cut-2)
Genomic Alteration: WBGene00009983(cut-2)
Availability: unknown
Source References: EMPTY
Synonyms: cut-2(wrd233[cut-2::mNG::3xFLAG]) V.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous cut-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Proper citation: RRID:WB-STRAIN:WBStrain00062635 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062628

Source Database: WormBase (WB)
Affected Genes: WBGene00003553(nas-37)
Genomic Alteration: WBGene00003553(nas-37)
Availability: unknown
Source References: EMPTY
Synonyms: nas-37(wrd106[nas-37:::mNG::3xFLAG]) X.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous nas-37 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Proper citation: RRID:WB-STRAIN:WBStrain00062628 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062629

Source Database: WormBase (WB)
Affected Genes: WBGene00000788(cpz-1)
Genomic Alteration: WBGene00000788(cpz-1)
Availability: unknown
Source References: EMPTY
Synonyms: cpz-1(wrd128[cpz-1::mNG::3xFLAG::linker]) I.
Notes: Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 4 of the endogenous cpz-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Proper citation: RRID:WB-STRAIN:WBStrain00062629 Copy   


  • RRID:WB-STRAIN:WBStrain00062626

http://www.wormbase.org/db/get?name=WBStrain00062626

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: K02D10.1(bet88) III.
Notes: Homozygous viable. Deletion of 2796 bp in parental strain N2. Left flanking sequence: tatgaactttaagaccaact; Right flanking sequence: ggatgggatgcaactgttgc. sgRNA #1: actcatactataagttcagt; sgRNA #2: ctacttgggcaaagccagga.|"Made_by: Bettinger lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062626 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062580

Source Database: WormBase (WB)
Affected Genes: WBGene00003271(mir-43)|WBGene00004140(ebax-1)
Genomic Alteration: WBGene00003271(mir-43), WBGene00004140(ebax-1)
Availability: unknown
Source References: EMPTY
Synonyms: mir-43(sjm2) II; ebax-1(tm2321) IV.
Notes: Homozygotes lack gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain also has a G>T point substitution at position 8 of miR-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm2) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna"

Proper citation: RRID:WB-STRAIN:WBStrain00062580 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062583

Source Database: WormBase (WB)
Affected Genes: WBGene00002246(lag-2)|WBGene00003001(lin-12)
Genomic Alteration: WBGene00002246(lag-2), WBGene00003001(lin-12)
Availability: unknown
Source References: EMPTY
Synonyms: cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V.
Notes: cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.|"Made_by: Taylor Medwig-Kinney and Theresa Gibney"

Proper citation: RRID:WB-STRAIN:WBStrain00062583 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062582

Source Database: WormBase (WB)
Affected Genes: WBGene00002246(lag-2)|WBGene00003001(lin-12)
Genomic Alteration: WBGene00002246(lag-2), WBGene00003001(lin-12)
Availability: unknown
Source References: EMPTY
Synonyms: lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V.
Notes: Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.|"Made_by: Taylor Medwig-Kinney and Ariel Pani"

Proper citation: RRID:WB-STRAIN:WBStrain00062582 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062585

Source Database: WormBase (WB)
Affected Genes: WBGene00002246(lag-2)|WBGene00003001(lin-12)
Genomic Alteration: WBGene00002246(lag-2), WBGene00003001(lin-12)
Availability: unknown
Source References: EMPTY
Synonyms: cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V.
Notes: cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.|"Made_by: Theresa Gibney and Taylor Medwig-Kinney"

Proper citation: RRID:WB-STRAIN:WBStrain00062585 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062586

Source Database: WormBase (WB)
Affected Genes: WBGene00002246(lag-2)|WBGene00003001(lin-12)
Genomic Alteration: WBGene00002246(lag-2), WBGene00003001(lin-12)
Availability: unknown
Source References: EMPTY
Synonyms: cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V.
Notes: cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.|"Made_by: Theresa Gibney and Taylor Medwig-Kinney"

Proper citation: RRID:WB-STRAIN:WBStrain00062586 Copy   


  • RRID:WB-STRAIN:WBStrain00062625

http://www.wormbase.org/db/get?name=WBStrain00062625

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Y116F11B.14(bet83) V.
Notes: Homozygous viable. Deletion of 1493 bp in parental strain N2. Left flanking sequence: attaatttttgaatttcctaca; Right flanking sequence: tgacgggctaatattgaatta. sgRNA #1: attacactataataatgtgt; sgRNA #2: aaacgacaaactcattatga.|"Made_by: Bettinger lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062625 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062622

Source Database: WormBase (WB)
Affected Genes: WBGene00022629(algn-12)
Genomic Alteration: WBGene00022629(algn-12)
Availability: unknown
Source References: EMPTY
Synonyms: algn-12(bet74) V/nT1[qls51] (IV;V).
Notes: Homozygous sterile. Balanced by nT1[qIs51]. Deletion of 3471 bp in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa.|"Made_by: Bettinger lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062622 Copy   


  • RRID:WB-STRAIN:WBStrain00062617

http://www.wormbase.org/db/get?name=WBStrain00062617

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Y76A2B.4(bet65) III.
Notes: Homozygous viable. Deletion of 1579 bp in parental strain N2. Left flanking sequence: gcaaaaaaaaacataccaga; Right flanking sequence: cgtggtttcaggccattacg. sgRNA #1: cctcactgatgatcgtcatc; sgRNA #2: aaaggttcagcattcacacg.|"Made_by: Bettinger lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062617 Copy   


  • RRID:WB-STRAIN:WBStrain00062618

http://www.wormbase.org/db/get?name=WBStrain00062618

Source Database: WormBase (WB)
Affected Genes: WBGene00016665(chil-11)
Genomic Alteration: WBGene00016665(chil-11)
Availability: unknown
Source References: EMPTY
Synonyms: chil-11(bet66) IV.
Notes: Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.|"Made_by: Bettinger lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062618 Copy   


  • RRID:WB-STRAIN:WBStrain00062616

http://www.wormbase.org/db/get?name=WBStrain00062616

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Y67H2A.2(bet63) IV.
Notes: Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat.|"Made_by: Bettinger lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062616 Copy   


  • RRID:WB-STRAIN:WBStrain00062572

http://www.wormbase.org/db/get?name=WBStrain00062572

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: dmaEx617.
Notes: dmaEx617 [fshr-1p::fshr-1::GFP + unc-54p::mCherry]. Pick mCherry+ animals to maintain. Extrachromosomal fshr-1p::fshr-1::GFP translation reporter. Reference: Wang C, et al. Aging Cell. 2023 Jan;22(1):e13735. doi: 10.1111/acel.13735. PMID: 36415159.|"Made_by: Dengke Ma Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00062572 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X