Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
NL2013 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00028990 | Caenorhabditis elegans | rsd-3(pk2013) X. | mut-6 background|"Resistant to feeding dsRNA." | WBGene00004682(rsd-3) | WBGene00004682(rsd-3) | WB-STRAIN:WBStrain00028990 | WormBase (WB) | WB | available | WB-STRAIN:NL2013, CGC_NL2013 | 2026-09-12 11:15:51 | 1 | |||
|
NL557 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028907 | Caenorhabditis elegans | dpy-20(e1362) IV; pkIs334. | pkIs334 [gsa-1(+) + dpy-20(+)]. gsa-1 overexpression. The strain is Egl-c and moves actively. | WBGene00001079(dpy-20) | WBGene00001079(dpy-20) | WB-STRAIN:WBStrain00028907 | WormBase (WB) | WB | available | PMID:9203577 | WB-STRAIN:NL557, CGC_NL557 | 2026-09-12 11:15:50 | 0 | ||
|
NL581 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028908 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00028908 | WormBase (WB) | WB | unknown | WB-STRAIN:NL581 | 2026-09-12 11:15:50 | 0 | |||||
|
NL361 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028903 | Caenorhabditis elegans | gpb-1(pk44) II; pkEx170. | Made_by: Zwaal and Plasterk|"pkEx170 [(pRP403) gpb-1(+) + (pRF4) rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene."|"pkEx170 [gpb-1(+) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene." | WBGene00001679(gpb-1) | WBGene00001679(gpb-1) | WB-STRAIN:WBStrain00028903 | WormBase (WB) | WB | available | PMID:8752216 | WB-STRAIN:NL361, CGC_NL361 | 2026-09-12 11:15:50 | 0 | ||
|
NL520 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028904 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00002016(hsp-16.2) | WBGene00002016(hsp-16.2) | WB-STRAIN:WBStrain00028904 | WormBase (WB) | WB | unknown | WB-STRAIN:NL520 | 2026-09-12 11:15:50 | 0 | |||
|
NL542 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028905 | Caenorhabditis elegans | gsa-1(pk75) I; pkEx270. | pkEx270 [rol-6(su1006) + gsa-1(+)]. pk75 is an L1 larval lethal. The strain segregates Rollers and L1 lethals. | WBGene00001745(gsa-1) | WBGene00001745(gsa-1) | WB-STRAIN:WBStrain00028905 | WormBase (WB) | WB | available | PMID:9203577 | WB-STRAIN:NL542, CGC_NL542 | 2026-09-12 11:15:50 | 0 | ||
|
NL348 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028902 | Caenorhabditis elegans | gpa-2(pk16) gpa-3(pk35) V. | Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation. | WBGene00001664(gpa-2)|WBGene00001665(gpa-3) | WBGene00001664(gpa-2), WBGene00001665(gpa-3) | WB-STRAIN:WBStrain00028902 | WormBase (WB) | WB | available | PMID:9055081 | WB-STRAIN:NL348, CGC_NL348 | 2026-09-12 11:15:50 | 0 | ||
|
NL1925 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028983 | Caenorhabditis elegans | acy-1(pk884) III; dpy-20(e1362) IV; pkIs296 X. | pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. | WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2) | WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2) | WB-STRAIN:WBStrain00028983 | WormBase (WB) | WB | available | WB-STRAIN:NL1925, CGC_NL1925 | 2026-09-12 11:15:51 | 0 | |||
|
NL1999 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028985 | Caenorhabditis elegans | acy-1(pk1279)/dpy-17(e164) III. | Heterozygotes are wild-type and segregate Dpys, wild-type, and arrested larvae that hardly move or pump. Suppressor of activated Gs. sgs-1 also called acy-1. | WBGene00000068(acy-1)|WBGene00001076(dpy-17) | WBGene00000068(acy-1), WBGene00001076(dpy-17) | WB-STRAIN:WBStrain00028985 | WormBase (WB) | WB | available | WB-STRAIN:NL1999, CGC_NL1999 | 2026-09-12 11:15:51 | 0 | |||
|
NL2001 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00028986 | Caenorhabditis elegans | gpb-2(pk751) I. | Flanking sequence: AGTCACTCTT - deletion - GAAGACTACT. | WBGene00001680(gpb-2) | WBGene00001680(gpb-2) | WB-STRAIN:WBStrain00028986 | WormBase (WB) | WB | available | WB-STRAIN:NL2001, CGC_NL2001 | 2026-09-12 11:15:51 | 1 | |||
|
NL1909 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028981 | Caenorhabditis elegans | acy-1(pk867) III; dpy-20(e1362) IV; pkIs296 X. | pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. | WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2) | WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2) | WB-STRAIN:WBStrain00028981 | WormBase (WB) | WB | available | WB-STRAIN:NL1909, CGC_NL1909 | 2026-09-12 11:15:51 | 0 | |||
|
NL1921 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028982 | Caenorhabditis elegans | acy-1(pk880) III; dpy-20(e1362) IV; pkIs296 X. | pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1. | WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2) | WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2) | WB-STRAIN:WBStrain00028982 | WormBase (WB) | WB | available | WB-STRAIN:NL1921, CGC_NL1921 | 2026-09-12 11:15:51 | 0 | |||
|
NL1832 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028976 | Caenorhabditis elegans | T24C4.1(pk732) III. | EMPTY | WBGene00020757(ucr-2.3) | WBGene00020757(ucr-2.3) | WB-STRAIN:WBStrain00028976 | WormBase (WB) | WB | available | WB-STRAIN:NL1832, CGC_NL1832 | 2026-09-12 11:15:51 | 0 | |||
|
NL1834 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028977 | Caenorhabditis elegans | mut-9(pk734) | Mutator. | WBGene00003506(mut-9) | WBGene00003506(mut-9) | WB-STRAIN:WBStrain00028977 | WormBase (WB) | WB | available | WB-STRAIN:NL1834, CGC_NL1834 | 2026-09-12 11:15:51 | 0 | |||
|
NL1838 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00028978 | Caenorhabditis elegans | mut-14(pk738) | Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA. | WBGene00003507(mut-14) | WBGene00003507(mut-14) | WB-STRAIN:WBStrain00028978 | WormBase (WB) | WB | available | WB-STRAIN:NL1838, CGC_NL1838 | 2026-09-12 11:15:51 | 1 | |||
|
NL1888 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028979 | Caenorhabditis elegans | pash-1(pk2083)/+ I; pkIs2084. | pkIs2084 [col-10::LacZ::lin-41 + goa-1::GFP]. Heterozygous. pash-1(pk2083)/+ heterozygotes look wild-type and will segregate pash-1(pk2083)/+ heterozygotes, sterile pk2083 homozygotes, and wild-type. Pick wild-type heterozygotes and check for segregation of sterile progeny to maintain. | WBGene00011908(pash-1) | WBGene00011908(pash-1) | WB-STRAIN:WBStrain00028979 | WormBase (WB) | WB | available | WB-STRAIN:NL1888, CGC_NL1888 | 2026-09-12 11:15:51 | 0 | |||
|
NL1820 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028975 | Caenorhabditis elegans | mut-7(pk720) III. | Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator. | WBGene00003504(mut-7) | WBGene00003504(mut-7) | WB-STRAIN:WBStrain00028975 | WormBase (WB) | WB | available | WB-STRAIN:NL1820, CGC_NL1820 | 2026-09-12 11:15:51 | 0 | |||
|
NL737 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028929 | Caenorhabditis elegans | rde-3(r459) I; mek-1(pk97) X. | K08A8.1 Previously called kin-17(pk97). | WBGene00003185(mek-1) | WBGene00003185(mek-1) | WB-STRAIN:WBStrain00028929 | WormBase (WB) | WB | available | WB-STRAIN:NL737, CGC_NL737 | 2026-09-12 11:15:50 | 0 | |||
|
NL713 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028920 | Caenorhabditis elegans | rde-3(r459) I; sox-2(pk65). | K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.|"Made_by: M Vroomen" | WBGene00004949(sox-2) | WBGene00004949(sox-2) | WB-STRAIN:WBStrain00028920 | WormBase (WB) | WB | available | WB-STRAIN:NL713, CGC_NL713 | 2026-09-12 11:15:50 | 0 | |||
|
NL687 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028914 | Caenorhabditis elegans | dcr-1(pk1351)/+ III. | Heterozygotes are WT and segregate WT and animals with protruding vulvas (dcr-1 homozygotes).|"Made_by: Fischer/Thijssen"|"Mutagen:UV/TMP"|"no longer available from the CGC." | WBGene00000939(dcr-1) | WBGene00000939(dcr-1) | WB-STRAIN:WBStrain00028914 | WormBase (WB) | WB | available | WB-STRAIN:NL687, CGC_NL687 | 2026-09-12 11:15:50 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.