Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
NL2013
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00028990 Caenorhabditis elegans rsd-3(pk2013) X. mut-6 background|"Resistant to feeding dsRNA." WBGene00004682(rsd-3) WBGene00004682(rsd-3) WB-STRAIN:WBStrain00028990 WormBase (WB) WB available WB-STRAIN:NL2013, CGC_NL2013 2026-09-12 11:15:51 1
NL557
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028907 Caenorhabditis elegans dpy-20(e1362) IV; pkIs334. pkIs334 [gsa-1(+) + dpy-20(+)]. gsa-1 overexpression. The strain is Egl-c and moves actively. WBGene00001079(dpy-20) WBGene00001079(dpy-20) WB-STRAIN:WBStrain00028907 WormBase (WB) WB available PMID:9203577 WB-STRAIN:NL557, CGC_NL557 2026-09-12 11:15:50 0
NL581
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028908 Caenorhabditis elegans EMPTY EMPTY WB-STRAIN:WBStrain00028908 WormBase (WB) WB unknown WB-STRAIN:NL581 2026-09-12 11:15:50 0
NL361
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028903 Caenorhabditis elegans gpb-1(pk44) II; pkEx170. Made_by: Zwaal and Plasterk|"pkEx170 [(pRP403) gpb-1(+) + (pRF4) rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene."|"pkEx170 [gpb-1(+) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene." WBGene00001679(gpb-1) WBGene00001679(gpb-1) WB-STRAIN:WBStrain00028903 WormBase (WB) WB available PMID:8752216 WB-STRAIN:NL361, CGC_NL361 2026-09-12 11:15:50 0
NL520
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028904 Caenorhabditis elegans EMPTY EMPTY WBGene00002016(hsp-16.2) WBGene00002016(hsp-16.2) WB-STRAIN:WBStrain00028904 WormBase (WB) WB unknown WB-STRAIN:NL520 2026-09-12 11:15:50 0
NL542
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028905 Caenorhabditis elegans gsa-1(pk75) I; pkEx270. pkEx270 [rol-6(su1006) + gsa-1(+)]. pk75 is an L1 larval lethal. The strain segregates Rollers and L1 lethals. WBGene00001745(gsa-1) WBGene00001745(gsa-1) WB-STRAIN:WBStrain00028905 WormBase (WB) WB available PMID:9203577 WB-STRAIN:NL542, CGC_NL542 2026-09-12 11:15:50 0
NL348
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028902 Caenorhabditis elegans gpa-2(pk16) gpa-3(pk35) V. Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation. WBGene00001664(gpa-2)|WBGene00001665(gpa-3) WBGene00001664(gpa-2), WBGene00001665(gpa-3) WB-STRAIN:WBStrain00028902 WormBase (WB) WB available PMID:9055081 WB-STRAIN:NL348, CGC_NL348 2026-09-12 11:15:50 0
NL1925
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028983 Caenorhabditis elegans acy-1(pk884) III; dpy-20(e1362) IV; pkIs296 X. pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2) WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2) WB-STRAIN:WBStrain00028983 WormBase (WB) WB available WB-STRAIN:NL1925, CGC_NL1925 2026-09-12 11:15:51 0
NL1999
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028985 Caenorhabditis elegans acy-1(pk1279)/dpy-17(e164) III. Heterozygotes are wild-type and segregate Dpys, wild-type, and arrested larvae that hardly move or pump. Suppressor of activated Gs. sgs-1 also called acy-1. WBGene00000068(acy-1)|WBGene00001076(dpy-17) WBGene00000068(acy-1), WBGene00001076(dpy-17) WB-STRAIN:WBStrain00028985 WormBase (WB) WB available WB-STRAIN:NL1999, CGC_NL1999 2026-09-12 11:15:51 0
NL2001
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00028986 Caenorhabditis elegans gpb-2(pk751) I. Flanking sequence: AGTCACTCTT - deletion - GAAGACTACT. WBGene00001680(gpb-2) WBGene00001680(gpb-2) WB-STRAIN:WBStrain00028986 WormBase (WB) WB available WB-STRAIN:NL2001, CGC_NL2001 2026-09-12 11:15:51 1
NL1909
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028981 Caenorhabditis elegans acy-1(pk867) III; dpy-20(e1362) IV; pkIs296 X. pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2) WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2) WB-STRAIN:WBStrain00028981 WormBase (WB) WB available WB-STRAIN:NL1909, CGC_NL1909 2026-09-12 11:15:51 0
NL1921
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028982 Caenorhabditis elegans acy-1(pk880) III; dpy-20(e1362) IV; pkIs296 X. pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1. WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2) WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2) WB-STRAIN:WBStrain00028982 WormBase (WB) WB available WB-STRAIN:NL1921, CGC_NL1921 2026-09-12 11:15:51 0
NL1832
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028976 Caenorhabditis elegans T24C4.1(pk732) III. EMPTY WBGene00020757(ucr-2.3) WBGene00020757(ucr-2.3) WB-STRAIN:WBStrain00028976 WormBase (WB) WB available WB-STRAIN:NL1832, CGC_NL1832 2026-09-12 11:15:51 0
NL1834
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028977 Caenorhabditis elegans mut-9(pk734) Mutator. WBGene00003506(mut-9) WBGene00003506(mut-9) WB-STRAIN:WBStrain00028977 WormBase (WB) WB available WB-STRAIN:NL1834, CGC_NL1834 2026-09-12 11:15:51 0
NL1838
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00028978 Caenorhabditis elegans mut-14(pk738) Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA. WBGene00003507(mut-14) WBGene00003507(mut-14) WB-STRAIN:WBStrain00028978 WormBase (WB) WB available WB-STRAIN:NL1838, CGC_NL1838 2026-09-12 11:15:51 1
NL1888
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028979 Caenorhabditis elegans pash-1(pk2083)/+ I; pkIs2084. pkIs2084 [col-10::LacZ::lin-41 + goa-1::GFP]. Heterozygous. pash-1(pk2083)/+ heterozygotes look wild-type and will segregate pash-1(pk2083)/+ heterozygotes, sterile pk2083 homozygotes, and wild-type. Pick wild-type heterozygotes and check for segregation of sterile progeny to maintain. WBGene00011908(pash-1) WBGene00011908(pash-1) WB-STRAIN:WBStrain00028979 WormBase (WB) WB available WB-STRAIN:NL1888, CGC_NL1888 2026-09-12 11:15:51 0
NL1820
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028975 Caenorhabditis elegans mut-7(pk720) III. Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator. WBGene00003504(mut-7) WBGene00003504(mut-7) WB-STRAIN:WBStrain00028975 WormBase (WB) WB available WB-STRAIN:NL1820, CGC_NL1820 2026-09-12 11:15:51 0
NL737
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028929 Caenorhabditis elegans rde-3(r459) I; mek-1(pk97) X. K08A8.1 Previously called kin-17(pk97). WBGene00003185(mek-1) WBGene00003185(mek-1) WB-STRAIN:WBStrain00028929 WormBase (WB) WB available WB-STRAIN:NL737, CGC_NL737 2026-09-12 11:15:50 0
NL713
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028920 Caenorhabditis elegans rde-3(r459) I; sox-2(pk65). K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.|"Made_by: M Vroomen" WBGene00004949(sox-2) WBGene00004949(sox-2) WB-STRAIN:WBStrain00028920 WormBase (WB) WB available WB-STRAIN:NL713, CGC_NL713 2026-09-12 11:15:50 0
NL687
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028914 Caenorhabditis elegans dcr-1(pk1351)/+ III. Heterozygotes are WT and segregate WT and animals with protruding vulvas (dcr-1 homozygotes).|"Made_by: Fischer/Thijssen"|"Mutagen:UV/TMP"|"no longer available from the CGC." WBGene00000939(dcr-1) WBGene00000939(dcr-1) WB-STRAIN:WBStrain00028914 WormBase (WB) WB available WB-STRAIN:NL687, CGC_NL687 2026-09-12 11:15:50 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.