Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 150 showing 2981 ~ 3000 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00028756

http://www.wormbase.org/db/get?name=WBStrain00028756

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001102(dsh-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001102(dsh-2)
Availability: available
Source References: EMPTY
Synonyms: dsh-2(or302)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:NG3124, CGC_NG3124
Notes: mIs14 [myo-2p::GFP + pes-10p::GFP]. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP or302 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. or302 homozygotes are GFP- and are Emb, ABar and have EMS spindle misalignment. or302 is a deletion starting at 503 and ending at 1578 of C27A2.6.

Proper citation: RRID:WB-STRAIN:WBStrain00028756 Copy   


  • RRID:WB-STRAIN:WBStrain00028754

http://www.wormbase.org/db/get?name=WBStrain00028754

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00006768(unc-32)
Availability: available
Source References: PMID:8462848
Synonyms: yDf10 unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:NG2618, CGC_NG2618
Notes: Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. Derived from strain TY1353. Grows fairly slowly but seems more stable than TY1353, which gives lots of steriles.

Proper citation: RRID:WB-STRAIN:WBStrain00028754 Copy   


  • RRID:WB-STRAIN:WBStrain00028792

http://www.wormbase.org/db/get?name=WBStrain00028792

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC237
Notes: Isotype: NIC236|"Reference_strain: False"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028792 Copy   


  • RRID:WB-STRAIN:WBStrain00028793

http://www.wormbase.org/db/get?name=WBStrain00028793

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC242
Notes: Isolated at IGC (Instituto Gulbenkian de Cincia)|"Isotype: NIC242"|"Reference_strain: True"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028793 Copy   


  • RRID:WB-STRAIN:WBStrain00028794

http://www.wormbase.org/db/get?name=WBStrain00028794

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33593818, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC251
Notes: Isolated in the Azores, on the island of So Jorge|"Isolation_date_comment: Only year and month are known (08-2012)"|"Isotype: NIC251"|"Reference_strain: True"|"Sequenced: True"|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00028794 Copy   


  • RRID:WB-STRAIN:WBStrain00028795

http://www.wormbase.org/db/get?name=WBStrain00028795

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:37008729, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC252
Notes: Isolated in the Azores, on the island of So Jorge|"Isolation_date_comment: Only year and month are known (08-2012)"|"Isotype: NIC252"|"Reference_strain: True"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028795 Copy   


  • RRID:WB-STRAIN:WBStrain00028790

http://www.wormbase.org/db/get?name=WBStrain00028790

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC232
Notes: Isotype: NIC231|"Reference_strain: False"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028790 Copy   


  • RRID:WB-STRAIN:WBStrain00028791

http://www.wormbase.org/db/get?name=WBStrain00028791

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC236
Notes: Isotype: NIC236|"Reference_strain: True"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028791 Copy   


  • RRID:WB-STRAIN:WBStrain00028707

http://www.wormbase.org/db/get?name=WBStrain00028707

Source Database: WormBase (WB)
Affected Genes: WBGene00001403(fbl-1)
Genomic Alteration: WBGene00001403(fbl-1)
Availability: available
Source References: EMPTY
Synonyms: fbl-1(k206) IV.
Alternate IDs: WB-STRAIN:NF774, CGC_NF774
Notes: Isolated as a dominant suppressor of DTC migration defects of mig-17(k174). The fbl-1(k206) single mutant has weak DTC migration defects.

Proper citation: RRID:WB-STRAIN:WBStrain00028707 Copy   


  • RRID:WB-STRAIN:WBStrain00028789

http://www.wormbase.org/db/get?name=WBStrain00028789

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC231
Notes: Isotype: NIC231|"Reference_strain: True"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028789 Copy   


  • RRID:WB-STRAIN:WBStrain00028702

http://www.wormbase.org/db/get?name=WBStrain00028702

Source Database: WormBase (WB)
Affected Genes: WBGene00005023(sqv-5)
Genomic Alteration: WBGene00005023(sqv-5)
Availability: available
Source References: PMID:26944260
Synonyms: sqv-5(k175) I.
Alternate IDs: WB-STRAIN:NF199, CGC_NF199
Notes: DTC migration defect.

Proper citation: RRID:WB-STRAIN:WBStrain00028702 Copy   


  • RRID:WB-STRAIN:WBStrain00028704

http://www.wormbase.org/db/get?name=WBStrain00028704

Source Database: WormBase (WB)
Affected Genes: WBGene00003254(mig-23)
Genomic Alteration: WBGene00003254(mig-23)
Availability: available
Source References: EMPTY
Synonyms: mig-23(k180) X.
Alternate IDs: WB-STRAIN:NF317, CGC_NF317
Notes: Distal tip cell migration defective. Tc1 insertion mutant. Spontaneous mutant with ventral white patch phenotype.

Proper citation: RRID:WB-STRAIN:WBStrain00028704 Copy   


  • RRID:WB-STRAIN:WBStrain00028787

http://www.wormbase.org/db/get?name=WBStrain00028787

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC200
Notes: Isotype: NIC199|"Reference_strain: False"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028787 Copy   


  • RRID:WB-STRAIN:WBStrain00028781

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00028781

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC166
Notes: Isotype: NIC166|"Reference_strain: True"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028781 Copy   


  • RRID:WB-STRAIN:WBStrain00028782

http://www.wormbase.org/db/get?name=WBStrain00028782

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC195
Notes: Isotype: NIC195|"Reference_strain: True"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028782 Copy   


  • RRID:WB-STRAIN:WBStrain00028780

http://www.wormbase.org/db/get?name=WBStrain00028780

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC4
Notes: Isotype: NIC3|"Reference_strain: False"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028780 Copy   


  • RRID:WB-STRAIN:WBStrain00028774

http://www.wormbase.org/db/get?name=WBStrain00028774

Source Database: WormBase (WB)
Affected Genes: WBGene00001184(egl-15)|WBGene00003056(lon-2)
Genomic Alteration: WBGene00001184(egl-15), WBGene00003056(lon-2)
Availability: available
Source References: PMID:7585964
Synonyms: +/szT1 [lon-2(e678)] I; egl-15(n1456)/szT1 X.
Alternate IDs: WB-STRAIN:NH2693, CGC_NH2693
Notes: Heterozygotes are WT and segregate WT, Lon Males, early L1 larval arrested animals (n1456 homozygotes) and dead eggs. n1456 is an early nonsense mutation in the extracellular domain of EGL-15/FGFR (Q268 STOP).|"Made_by: R. Burdine"

Proper citation: RRID:WB-STRAIN:WBStrain00028774 Copy   


  • RRID:WB-STRAIN:WBStrain00028775

http://www.wormbase.org/db/get?name=WBStrain00028775

Source Database: WormBase (WB)
Affected Genes: WBGene00001184(egl-15)|WBGene00003559(ncl-1)
Genomic Alteration: WBGene00001184(egl-15), WBGene00003559(ncl-1)
Availability: available
Source References: EMPTY
Synonyms: ncl-1(e1865) III; egl-15(n1456) X; ayEx86.
Alternate IDs: WB-STRAIN:NH3027, CGC_NH3027
Notes: ayEx86 [col-19::GFP + egl-15(+) (NH#112) + ncl-1(+)(c33c3)]. Maintain by picking non-Egl. Referene: Lo TW, et al. Dev Biol. 2008 Jun 15;318(2):268-75.|"Made_by: Catherine Branda"

Proper citation: RRID:WB-STRAIN:WBStrain00028775 Copy   


  • RRID:WB-STRAIN:WBStrain00028776

http://www.wormbase.org/db/get?name=WBStrain00028776

Source Database: WormBase (WB)
Affected Genes: WBGene00018788(shc-1)
Genomic Alteration: WBGene00018788(shc-1)
Availability: available
Source References: EMPTY
Synonyms: F54A5.3a(ok198) I.
Alternate IDs: WB-STRAIN:NH3119, CGC_NH3119
Notes: Mutagen:UV/TMP|"No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3."

Proper citation: RRID:WB-STRAIN:WBStrain00028776 Copy   


  • RRID:WB-STRAIN:WBStrain00028723

http://www.wormbase.org/db/get?name=WBStrain00028723

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: vlcEx800.
Alternate IDs: WB-STRAIN:NFB1352, CGC_NFB1352
Notes: Made_by: Carla Lloret & Carlos Mora|"vlcEx800 [pan-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains pan-1 enhancer sequence (-1050, -148) inserted into pDD95.75. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785."

Proper citation: RRID:WB-STRAIN:WBStrain00028723 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X