Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VZ14 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040312 | Caenorhabditis elegans | trxr-2(tm2047) III; trxr-1(sv47) IV. | Made_by: B. Cacho Valadez|"sv47 deletion removes bases 721-2383 of the trxr-1 genomic sequence (as measured from the start of the trxr-1 coding sequence). tm2047 removes bases -128 to +380 relative to the start of the trxr-2 coding sequence (removing part of the proximal promoter). tm2047 outcrossed 6x. sv47 outcrossed 10x. Reference: Cacho-Valadez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400." | WBGene00014028(trxr-2)|WBGene00015553(trxr-1) | WBGene00014028(trxr-2), WBGene00015553(trxr-1) | WB-STRAIN:WBStrain00040312 | WormBase (WB) | WB | available | WB-STRAIN:VZ14, CGC_VZ14 | 2026-09-12 11:18:24 | 0 | |||
|
VZ184 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040325 | Caenorhabditis elegans | vzEx60. | Made_by: F Muoz Lobato|"vzEx60 [dnj-27p(2kb)::dnj-27::YFP::KDEL]. Superficially wild-type. Pick YFP+ to maintain. Fluorescence should be easily detected under a dissection scope if present, but array has low transmission rate. Reference: Muoz-Lobato F, et al. Antioxid Redox Signal. 2014 Jan 10; 20(2): 217-235."|"vzEx60 [dnj-27p(2kb)::dnj-27::YFP::KDEL]. Superficially wild-type. Pick YFP+ to maintain. Reference: Muoz-Lobato F, et al. Antioxid Redox Signal. 2014 Jan 10; 20(2): 217-235." | WB-STRAIN:WBStrain00040325 | WormBase (WB) | WB | available | WB-STRAIN:VZ184, CGC_VZ184 | 2026-09-12 11:18:24 | 0 | |||||
|
VZ454 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040328 | Caenorhabditis elegans | gsr-1(tm3574)/qC1 dpy-19(e1259) glp-1(q339) nIs281 III. | Made_by: Francisco Jos Naranjo-Galindo|"nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61." | WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00008117(gsr-1) | WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00008117(gsr-1) | WB-STRAIN:WBStrain00040328 | WormBase (WB) | WB | available | WB-STRAIN:VZ454, CGC_VZ454 | 2026-09-12 11:18:24 | 0 | |||
|
VZ119 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040322 | Caenorhabditis elegans | vzEx32. | vzEx32 [(pVZ35) trx-3p::GFP + (pRF4) rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP expression in intestine. Reference: Jimnez-Hidalgo M, et al. Free Radic Biol Med. (2014) 68:205-219.|"vzEx32 [trx-3p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP expression in intestine. Reference: Jimnez-Hidalgo M, et al. Free Radic Biol Med. (2014) 68:205-219." | WB-STRAIN:WBStrain00040322 | WormBase (WB) | WB | available | WB-STRAIN:VZ119, CGC_VZ119 | 2026-09-12 11:18:24 | 0 | |||||
|
VZ149 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040324 | Caenorhabditis elegans | vzEx41. | Made_by: F Muoz Lobato|"vzEx41 [dnj-27p(2kb)::dnj-27::dnj-27 3'UTR + unc-122p::GFP]. Superficially wild-type. Pick GFP+ to maintain. Reference: Muoz-Lobato F, et al. Antioxid Redox Signal. 2014 Jan 10; 20(2): 217-235." | WB-STRAIN:WBStrain00040324 | WormBase (WB) | WB | available | WB-STRAIN:VZ149, CGC_VZ149 | 2026-09-12 11:18:24 | 0 | |||||
|
WH216 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040372 | Caenorhabditis elegans | sep-1(e2406) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Heterozygotes have myo-2::GFP [qIs48] strongly expressed in the pharynx and are viable at 25C. 100% of sep-1 homozygotes are strongly Sterile Unc at 25C (at 20C, 100% are Sterile but no so Unc). Up to 30% of the homozygotes are Sterile at 16C. hT2[qIs48] homozygotes are dead. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.|"Reference WBPaper00059538 added based on published strain data identified by Textpresso literature search." | WBGene00000254(bli-4)|WBGene00004775(sep-1) | WBGene00000254(bli-4), WBGene00004775(sep-1) | WB-STRAIN:WBStrain00040372 | WormBase (WB) | WB | available | PMID:32273538 | WB-STRAIN:WH216, CGC_WH216 | 2026-09-12 11:18:24 | 0 | ||
|
WH202 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040370 | Caenorhabditis elegans | unc-61(n3169) V. | Poor backward movement. Protrusive vulva. Gonad extrusion. Egg-laying defects. Recessive. | WBGene00006795(unc-61) | WBGene00006795(unc-61) | WB-STRAIN:WBStrain00040370 | WormBase (WB) | WB | available | WB-STRAIN:WH202, CGC_WH202 | 2026-09-12 11:18:24 | 0 | |||
|
WH258 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040377 | Caenorhabditis elegans | unc-119(ed3) III; ojIs57. | ojIs57 [pie-1::GFP::dnc-2 + unc-119(+)]|"Supplementary_genotype unc-119(ed3) III; ojIs5" | WBGene00001018(dnc-2)|WBGene00006843(unc-119) | WBGene00001018(dnc-2), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00040377 | WormBase (WB) | WB | available | PMID:37684042 | WB-STRAIN:WH258, CGC_WH258 | 2026-09-12 11:18:25 | 0 | ||
|
WH259 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040378 | Caenorhabditis elegans | unc-119(ed3) III; ojIs47. | ojIs47 [arp-1::GFP + unc-119(+)]. | WBGene00006843(unc-119)|WBGene00013168(arp-1) | WBGene00006843(unc-119), WBGene00013168(arp-1) | WB-STRAIN:WBStrain00040378 | WormBase (WB) | WB | available | WB-STRAIN:WH259, CGC_WH259 | 2026-09-12 11:18:25 | 0 | |||
|
VV213 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040308 | Caenorhabditis elegans | Y53F4B.18(vq3) II. | Made_by: Alan To|"Superficially wild-type. Reference: Chen AL, et al. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0243-4." | WBGene00013164(Y53F4B.18) | WBGene00013164(Y53F4B.18) | WB-STRAIN:WBStrain00040308 | WormBase (WB) | WB | available | WB-STRAIN:VV213, CGC_VV213 | 2026-09-12 11:18:24 | 0 | |||
|
VZ1 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00040309 | Caenorhabditis elegans | trx-1(ok1449) II. | B0228.5 Homozygous. Exhibits slightly shortened lifespan compared to wild-type. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: www.mutantfactory.ouhsc.edu/ Reference: Miranda-Vizuete A, et al. FEBS Lett. 2006 Jan 23;580(2):484-90.|"Made_by: A. Miranda Vizuete"|"Supplementary_genotype trx-1(ok1449)" | WBGene00015062(trx-1) | WBGene00015062(trx-1) | WB-STRAIN:WBStrain00040309 | WormBase (WB) | WB | available | PMID:37258276 PMID:38446031 |
WB-STRAIN:VZ1, CGC_VZ1 | 2026-09-12 11:18:24 | 1 | ||
|
WH327 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00040383 | Caenorhabditis elegans | unc-119(ed3) III; ojIs23. | ojIs23 [pie-1p::GFP::C34B2.10].|"Reference WBPaper00055815 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype unc-119(ed3) III; ojIs23 [Ppie-1GFP::SP12]" | WBGene00004027(pie-1)|WBGene00006843(unc-119)|WBGene00016395(spcs-1) | WBGene00004027(pie-1), WBGene00006843(unc-119), WBGene00016395(spcs-1) | WB-STRAIN:WBStrain00040383 | WormBase (WB) | WB | available | PMID:30489010 PMID:37684042 PMID:39167497 |
WB-STRAIN:WH327, CGC_WH327 | 2026-09-12 11:18:25 | 2 | ||
|
WH0347 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040386 | Caenorhabditis elegans | EMPTY | Retired following removal of zero padded strain public_names. | WBGene00004274(rab-11.1) | WBGene00004274(rab-11.1) | WB-STRAIN:WBStrain00040386 | WormBase (WB) | WB | unknown | WB-STRAIN:WH0347 | 2026-09-12 11:18:25 | 0 | |||
|
WH279 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040380 | Caenorhabditis elegans | unc-119(ed3) III; ojIs12. | ojIs12 [cyk-4::GFP + unc-119(+)]. Strain is not very healthy. Described as integratred array but appears to segregate Uncs. Maintain at 15-20C. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00040380 | WormBase (WB) | WB | available | WB-STRAIN:WH279, CGC_WH279 | 2026-09-12 11:18:25 | 0 | |||
|
VT3301 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040304 | Caenorhabditis elegans | mir-794 mir-795(maDf5) I. | mir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11]. | WBGene00045328(mir-794)|WBGene00045329(mir-795) | WBGene00045328(mir-794), WBGene00045329(mir-795) | WB-STRAIN:WBStrain00040304 | WormBase (WB) | WB | available | WB-STRAIN:VT3301, CGC_VT3301 | 2026-09-12 11:18:23 | 0 | |||
|
VT3299 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040303 | Caenorhabditis elegans | mir-795(ma298) I; maIs105 V. | maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11]. | WBGene00045329(mir-795) | WBGene00045329(mir-795) | WB-STRAIN:WBStrain00040303 | WormBase (WB) | WB | available | WB-STRAIN:VT3299, CGC_VT3299 | 2026-09-12 11:18:23 | 0 | |||
|
VV207 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040306 | Caenorhabditis elegans | ser-7(vq2) X. | CRISPR/Cas9-engineered knockout of ser-7. Resistant to exogenous serotonin induced food intake. Reference: Perez-Gomez A., et al. Nat Commun. 2018 Dec 10;9(1):5272.|"Made_by: Alan To" | WBGene00004780(ser-7) | WBGene00004780(ser-7) | WB-STRAIN:WBStrain00040306 | WormBase (WB) | WB | available | WB-STRAIN:VV207, CGC_VV207 | 2026-09-12 11:18:24 | 0 | |||
|
VT3363 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040305 | Caenorhabditis elegans | nDf50/mIn1 [mIs14 dpy-10(e128)] II; nhl-2(ok818) III; her-1(n695) V. | Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437. | WBGene00001072(dpy-10)|WBGene00001842(her-1)|WBGene00003598(nhl-2) | WBGene00001072(dpy-10), WBGene00001842(her-1), WBGene00003598(nhl-2) | WB-STRAIN:WBStrain00040305 | WormBase (WB) | WB | unknown | WB-STRAIN:VT3363 | 2026-09-12 11:18:23 | 0 | |||
|
WH0351 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040388 | Caenorhabditis elegans | EMPTY | Retired following removal of zero padded strain public_names. | WBGene00004027(pie-1) | WBGene00004027(pie-1) | WB-STRAIN:WBStrain00040388 | WormBase (WB) | WB | unknown | WB-STRAIN:WH0351 | 2026-09-12 11:18:25 | 0 | |||
|
WH347 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040387 | Caenorhabditis elegans | unc-119(ed3) III; ojIs35. | Made_by: Jane Squirrell|"ojIs35 [pie-1::GFP::rab-11.1 + unc-119(+)]." | WBGene00004274(rab-11.1)|WBGene00006843(unc-119) | WBGene00004274(rab-11.1), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00040387 | WormBase (WB) | WB | available | WB-STRAIN:WH347, CGC_WH347 | 2026-09-12 11:18:25 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.