Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 139 showing 2761 ~ 2780 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00031055

http://www.wormbase.org/db/get?name=WBStrain00031055

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: cpn-4(sy1173) I
Alternate IDs: WB-STRAIN:PS8011
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031055 Copy   


  • RRID:WB-STRAIN:WBStrain00031053

http://www.wormbase.org/db/get?name=WBStrain00031053

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: ZC376.2(sy1171) V
Alternate IDs: WB-STRAIN:PS8009
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031053 Copy   


  • RRID:WB-STRAIN:WBStrain00031052

http://www.wormbase.org/db/get?name=WBStrain00031052

Source Database: WormBase (WB)
Affected Genes: WBGene00013874(cest-2.2)
Genomic Alteration: WBGene00013874(cest-2.2)
Availability: available
Source References: PMID:30224336
Synonyms: ZC376.2(sy1170) V.
Alternate IDs: WB-STRAIN:PS8008, CGC_PS8008
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"

Proper citation: RRID:WB-STRAIN:WBStrain00031052 Copy   


  • RRID:WB-STRAIN:WBStrain00031059

http://www.wormbase.org/db/get?name=WBStrain00031059

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: Y71H2AM.20(sy1177)/+ III
Alternate IDs: WB-STRAIN:PS8028
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031059 Copy   


  • RRID:WB-STRAIN:WBStrain00031025

http://www.wormbase.org/db/get?name=WBStrain00031025

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: aex-2(sy1079) X
Alternate IDs: WB-STRAIN:PS7838
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031025 Copy   


  • RRID:WB-STRAIN:WBStrain00031024

http://www.wormbase.org/db/get?name=WBStrain00031024

Source Database: WormBase (WB)
Affected Genes: WBGene00000085(aex-2)
Genomic Alteration: WBGene00000085(aex-2)
Availability: available
Source References: PMID:30224336, PMID:38590801
Synonyms: aex-2(sy1078) X.
Alternate IDs: WB-STRAIN:PS7837, CGC_PS7837
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATGRight flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCAinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"

Proper citation: RRID:WB-STRAIN:WBStrain00031024 Copy   


  • RRID:WB-STRAIN:WBStrain00031023

http://www.wormbase.org/db/get?name=WBStrain00031023

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: Y106G6H.8(sy1077) I
Alternate IDs: WB-STRAIN:PS7834
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031023 Copy   


  • RRID:WB-STRAIN:WBStrain00031021

http://www.wormbase.org/db/get?name=WBStrain00031021

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: K03E5.2(sy1087) I
Alternate IDs: WB-STRAIN:PS7784
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031021 Copy   


  • RRID:WB-STRAIN:WBStrain00031029

http://www.wormbase.org/db/get?name=WBStrain00031029

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: C01B10.10(sy1115) IV
Alternate IDs: WB-STRAIN:PS7859
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031029 Copy   


  • RRID:WB-STRAIN:WBStrain00031033

http://www.wormbase.org/db/get?name=WBStrain00031033

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: C56G2.15(sy1121) III
Alternate IDs: WB-STRAIN:PS7910
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031033 Copy   


  • RRID:WB-STRAIN:WBStrain00031031

http://www.wormbase.org/db/get?name=WBStrain00031031

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: C53C9.2(sy1117) X
Alternate IDs: WB-STRAIN:PS7899
Notes: aatatc

Proper citation: RRID:WB-STRAIN:WBStrain00031031 Copy   


  • RRID:WB-STRAIN:WBStrain00031038

http://www.wormbase.org/db/get?name=WBStrain00031038

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: cul-3(sy1153)/+ V
Alternate IDs: WB-STRAIN:PS7937
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031038 Copy   


  • RRID:WB-STRAIN:WBStrain00031037

http://www.wormbase.org/db/get?name=WBStrain00031037

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: C01B10.4(sy1132) IV
Alternate IDs: WB-STRAIN:PS7923
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031037 Copy   


  • RRID:WB-STRAIN:WBStrain00031124

http://www.wormbase.org/db/get?name=WBStrain00031124

Source Database: WormBase (WB)
Affected Genes: WBGene00001535(gcy-8)
Genomic Alteration: WBGene00001535(gcy-8)
Availability: available
Source References: EMPTY
Synonyms: oyls17.
Alternate IDs: WB-STRAIN:PY1157, CGC_PY1157
Notes: Made_by: Piali Sengupta's lab|"oyls17 [gcy-8p::GFP + lin-15(+)]. AFD neurons are marked with GFP. Used by CeNGEN project for RNA-Seq (https:"

Proper citation: RRID:WB-STRAIN:WBStrain00031124 Copy   


  • RRID:WB-STRAIN:WBStrain00031123

http://www.wormbase.org/db/get?name=WBStrain00031123

Source Database: WormBase (WB)
Affected Genes: WBGene00006070(str-2)|WBGene00006853(unc-130)
Genomic Alteration: WBGene00006070(str-2), WBGene00006853(unc-130)
Availability: available
Source References: EMPTY
Synonyms: unc-130(oy10) II.
Alternate IDs: WB-STRAIN:PY1133, CGC_PY1133
Notes: Made_by: T. Sarafi-Reinach|"Slighty Dpy. Slighty Unc. Ventral clear patch due to distal tip cell migration defects. Ectopic expression of AWA neuronal markers."

Proper citation: RRID:WB-STRAIN:WBStrain00031123 Copy   


  • RRID:WB-STRAIN:WBStrain00031127

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031127

Source Database: WormBase (WB)
Affected Genes: WBGene00001535(gcy-8)
Genomic Alteration: WBGene00001535(gcy-8)
Availability: available
Source References: PMID:38530893
Synonyms: oyIs18 [gcy-8p::gfp]
Alternate IDs: WB-STRAIN:PY1322, CGC_PY1322
Notes: oyIs18 [gcy-8::GFP]. GFP in AFD.

Proper citation: RRID:WB-STRAIN:WBStrain00031127 Copy   


  • RRID:WB-STRAIN:WBStrain00031135

http://www.wormbase.org/db/get?name=WBStrain00031135

Source Database: WormBase (WB)
Affected Genes: WBGene00002210(kin-29)|WBGene00003182(mef-2)
Genomic Alteration: WBGene00002210(kin-29), WBGene00003182(mef-2)
Availability: available
Source References: EMPTY
Synonyms: mef-2(oy65) I; kin-29(oy39) kyIs104 X.
Alternate IDs: WB-STRAIN:PY2223, CGC_PY2223
Notes: kyIs104 [str-1::GFP]. AWB expression of GFP. mef-2 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking.

Proper citation: RRID:WB-STRAIN:WBStrain00031135 Copy   


  • RRID:WB-STRAIN:WBStrain00031134

http://www.wormbase.org/db/get?name=WBStrain00031134

Source Database: WormBase (WB)
Affected Genes: WBGene00001535(gcy-8)
Genomic Alteration: WBGene00001535(gcy-8)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:PY1669
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00031134 Copy   


  • RRID:WB-STRAIN:WBStrain00031132

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031132

Source Database: WormBase (WB)
Affected Genes: WBGene00000553(cmk-1)
Genomic Alteration: WBGene00000553(cmk-1)
Availability: available
Source References: EMPTY
Synonyms: cmk-1(oy21) IV.
Alternate IDs: WB-STRAIN:PY1589, CGC_PY1589
Notes: Thermotaxis defective.

Proper citation: RRID:WB-STRAIN:WBStrain00031132 Copy   


  • RRID:WB-STRAIN:WBStrain00031131

http://www.wormbase.org/db/get?name=WBStrain00031131

Source Database: WormBase (WB)
Affected Genes: WBGene00004334(ref-1)
Genomic Alteration: WBGene00004334(ref-1)
Availability: available
Source References: EMPTY
Synonyms: ref-1(oy40) II.
Alternate IDs: WB-STRAIN:PY1539, CGC_PY1539
Notes: WT phenotype.

Proper citation: RRID:WB-STRAIN:WBStrain00031131 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X