Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Database:WB (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Species

Sort Ascending

Sort Descending

 Synonyms

Sort Ascending

Sort Descending

 Notes
Phenotype

Sort Ascending

Sort Descending

 Affected Gene

Sort Ascending

Sort Descending

 Genomic Alteration

Sort Ascending

Sort Descending

 Catalog Number
Background

Sort Ascending

Sort Descending

 Database

Sort Ascending

Sort Descending

 Database Abbreviation

Sort Ascending

Sort Descending

 Availability

Sort Ascending

Sort Descending

 Source References

Sort Ascending

Sort Descending

 Alternate IDs
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
PS3662
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00030904 Caenorhabditis elegans syIs63. syIs63 [cog-1::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"syIs63[cog-1::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects." WBGene00000584(cog-1) WBGene00000584(cog-1) WB-STRAIN:WBStrain00030904 WormBase (WB) WB available PMID:26024448 WB-STRAIN:PS3662, CGC_PS3662 2026-09-12 11:16:18 0
PS3653
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00030903 Caenorhabditis elegans ipp-5(sy605) X. Subtle ovulation defect which is viewable by Nomarski - 2 oocytes ovulate (pass into uterus) at the same time. Double mutants with lfe-2(sy326) and lfe-1(sy290) show sterility. Double mutant with lin-3(n1058) is fertile. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. WBGene00002146(ipp-5) WBGene00002146(ipp-5) WB-STRAIN:WBStrain00030903 WormBase (WB) WB available WB-STRAIN:PS3653, CGC_PS3653 2026-09-12 11:16:18 0
PS7169
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031002 Caenorhabditis elegans syIs337 syIs398 III. Made_by: Han Wang and Jonathan Liu|"syIs337 [15xUAS::pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." WB-STRAIN:WBStrain00031002 WormBase (WB) WB available WB-STRAIN:PS7169, CGC_PS7169 2026-09-12 11:16:19 0
PTM317
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031089 Caenorhabditis elegans nurf-1(kah91)II/ oxTi924 II N2 Background WB-STRAIN:WBStrain00031089 WormBase (WB) WB unknown WB-STRAIN:PTM317 2026-09-12 11:16:20 0
PTM288
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031086 Caenorhabditis elegans dpy-10 (kah83)II kyIR1(V, CB4856>N2) qgIR1(X, CB4856>N2). Information on this strain can be found in the following publication : https://www.biorxiv.org/content/early/2018/04/30/309997 WB-STRAIN:WBStrain00031086 WormBase (WB) WB unknown WB-STRAIN:PTM288 2026-09-12 11:16:20 0
PTM229
 
Resource Report
Resource Website
1+ mentions 		RRID:WB-STRAIN:WBStrain00031085 Caenorhabditis elegans dpy-10 (kah82)II. Information on this strain can be found in the following publication : https://www.biorxiv.org/content/early/2018/04/30/309997 WB-STRAIN:WBStrain00031085 WormBase (WB) WB unknown PMID:38771761 WB-STRAIN:PTM229 2026-09-12 11:16:20 1
PTM211
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031084 Caenorhabditis elegans nurf-1(kah66,kah73)II N2 Background WB-STRAIN:WBStrain00031084 WormBase (WB) WB unknown WB-STRAIN:PTM211 2026-09-12 11:16:20 0
PS7199
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031009 Caenorhabditis elegans syIs371 III. Made_by: Han Wang and Jonathan Liu|"syIs371"|"syIs371[15xUAS::pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. Histamine chloride channel cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." WB-STRAIN:WBStrain00031009 WormBase (WB) WB available PMID:38096407 WB-STRAIN:PS7199, CGC_PS7199 2026-09-12 11:16:19 0
PS7190
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031007 Caenorhabditis elegans syIs409 X. Made_by: Han Wang and Jonathan Liu|"syIs409"|"syIs409 [15xUAS::pes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript]. mCherry::H2B cGAL effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." WB-STRAIN:WBStrain00031007 WormBase (WB) WB available WB-STRAIN:PS7190, CGC_PS7190 2026-09-12 11:16:19 0
PS7185
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031005 Caenorhabditis elegans syIs406 IV. Made_by: Han Wang and Jonathan Liu|"syIs406 [15xUAS::pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. GFP::H2B effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." WB-STRAIN:WBStrain00031005 WormBase (WB) WB available WB-STRAIN:PS7185, CGC_PS7185 2026-09-12 11:16:19 0
PTM332
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031093 Caenorhabditis elegans nurf-1(kah106) II/ oxTi924 II N2 Background WB-STRAIN:WBStrain00031093 WormBase (WB) WB unknown WB-STRAIN:PTM332 2026-09-12 11:16:20 0
PTM325
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031092 Caenorhabditis elegans nurf-1(kah99)II/ oxTi924 II N2 Background WB-STRAIN:WBStrain00031092 WormBase (WB) WB unknown WB-STRAIN:PTM325 2026-09-12 11:16:20 0
PTM322
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031091 Caenorhabditis elegans nurf-1(kah96)II/ oxTi924 II N2 Background WB-STRAIN:WBStrain00031091 WormBase (WB) WB unknown WB-STRAIN:PTM322 2026-09-12 11:16:20 0
PS7731
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031014 Caenorhabditis elegans K03E5.2(sy1082) I. Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGGReference: Wang H, et al. G3 (Bethesda)." WBGene00019361(clik-3) WBGene00019361(clik-3) WB-STRAIN:WBStrain00031014 WormBase (WB) WB available PMID:30224336 WB-STRAIN:PS7731, CGC_PS7731 2026-09-12 11:16:19 0
PS7778
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031018 Caenorhabditis elegans clik-1(sy1084) V. Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagcReference: Wang H, et al. G3 (Bethesda)." WBGene00020808(clik-1) WBGene00020808(clik-1) WB-STRAIN:WBStrain00031018 WormBase (WB) WB available PMID:30224336 WB-STRAIN:PS7778, CGC_PS7778 2026-09-12 11:16:19 0
PS7735
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031017 Caenorhabditis elegans T05C3.2(sy1081) V STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc WB-STRAIN:WBStrain00031017 WormBase (WB) WB unknown PMID:30224336 WB-STRAIN:PS7735 2026-09-12 11:16:19 0
PS7734
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031016 Caenorhabditis elegans T05C3.2(sy1080) V. Made_by: Han Wang/Heenam Park/Wen Chen|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAARight flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" WBGene00020254(T05C3.2) WBGene00020254(T05C3.2) WB-STRAIN:WBStrain00031016 WormBase (WB) WB available PMID:30224336 WB-STRAIN:PS7734, CGC_PS7734 2026-09-12 11:16:19 0
PS7732
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031015 Caenorhabditis elegans K03E5.2 (sy1083) I STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc WB-STRAIN:WBStrain00031015 WormBase (WB) WB unknown PMID:30224336 WB-STRAIN:PS7732 2026-09-12 11:16:19 0
PT830
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00031068 Caenorhabditis elegans nphp-1(ok500) II; nphp-4(tm925) him-5(e1490) V. Made_by: A. Jauregui|"Male mating response defect." WBGene00001864(him-5)|WBGene00010898(nphp-1)|WBGene00011261(nphp-4) WBGene00001864(him-5), WBGene00010898(nphp-1), WBGene00011261(nphp-4) WB-STRAIN:WBStrain00031068 WormBase (WB) WB available PMID:38302462 WB-STRAIN:PT830, CGC_PT830 2026-09-12 11:16:20 0
PT709
 
Resource Report
Resource Website
1+ mentions 		RRID:WB-STRAIN:WBStrain00031067 Caenorhabditis elegans nphp-4(tm925) him-5(e1490) V. Made_by: A. Jauregui|"Superficially WT." WBGene00001864(him-5)|WBGene00011261(nphp-4) WBGene00001864(him-5), WBGene00011261(nphp-4) WB-STRAIN:WBStrain00031067 WormBase (WB) WB available WB-STRAIN:PT709, CGC_PT709 2026-09-12 11:16:20 1

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch