Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
QL402
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048588 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048588 WormBase (WB) WB unknown PMID:33357442 2026-09-05 04:56:30 0
SV2082
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048621 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048621 WormBase (WB) WB unknown PMID:32494730 2026-09-05 04:56:31 0
QL404
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048589 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048589 WormBase (WB) WB unknown PMID:33357442 2026-09-05 04:56:30 0
SV2105
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048623 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048623 WormBase (WB) WB unknown PMID:32494730 2026-09-05 04:56:31 0
SV2117
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048624 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048624 WormBase (WB) WB unknown PMID:32494730 2026-09-05 04:56:31 0
SV2122
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048625 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048625 WormBase (WB) WB unknown PMID:32494730 2026-09-05 04:56:31 0
ML1694
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048560 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048560 WormBase (WB) WB unknown PMID:33238119 2026-09-05 04:56:30 0
NVK233
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048562 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048562 WormBase (WB) WB unknown PMID:32600387 2026-09-05 04:56:30 0
LD1906
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048552 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048552 WormBase (WB) WB unknown PMID:33658510 2026-09-05 04:56:30 0
MAS91
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00048554 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"WBStrain provided so WBPaper00061495 paper added based on AFP_Strain data." WB-STRAIN:WBStrain00048554 WormBase (WB) WB unknown PMID:32149606
PMID:38450962
2026-09-05 04:56:30 1
MAS96
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048555 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048555 WormBase (WB) WB unknown PMID:32149606 2026-09-05 04:56:30 0
ML1659
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048558 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048558 WormBase (WB) WB unknown PMID:33238119 2026-09-05 04:56:30 0
PMD13
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048571 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048571 WormBase (WB) WB unknown PMID:33674585
PMID:40118018
2026-09-05 04:56:30 0
PMD60
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048573 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048573 WormBase (WB) WB unknown PMID:33674585 2026-09-05 04:56:30 0
SV1894
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048604 Caenorhabditis elegans EMPTY Generated from papers flagged positive during the last month for data type afp_strain/other_strain. WB-STRAIN:WBStrain00048604 WormBase (WB) WB unknown PMID:32494730 2026-09-05 04:56:31 0
swsn-8(he273 he287 [LoxN exon 3 + LoxN last intron]) I; heSi208 V; heSi141 X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048606 Caenorhabditis elegans swsn-8(he273 he287 [LoxN exon 3 + LoxN last intron]) I; heSi208 V; heSi141 X. Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. he273 he287 homozygotes are Egl since they cannot form a functioning vulva due to swsn-8 inactivated in the mesoderm lineage by hlh-8p::CRE expression. LoxN sites in the endogenous swsn-8 locus facilitate inducible knockout of swsn-8. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730" WB-STRAIN:WBStrain00048606 WormBase (WB) WB unknown PMID:32494730 2026-09-05 04:56:31 0
unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V).
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048564 Caenorhabditis elegans unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain." WBGene00003161(mdf-2)|WBGene00006843(unc-119) WBGene00003161(mdf-2), WBGene00006843(unc-119) WB-STRAIN:WBStrain00048564 WormBase (WB) WB available PMID:31588029 CGC_OD2174 2026-09-05 04:56:30 0
cyb-3(lt110) V/nT1 [qIs51] (IV;V).
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048566 Caenorhabditis elegans cyb-3(lt110) V/nT1 [qIs51] (IV;V). CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain." WBGene00000868(cyb-3) WBGene00000868(cyb-3) WB-STRAIN:WBStrain00048566 WormBase (WB) WB available PMID:31588029 CGC_OD3737 2026-09-05 04:56:30 0
che-7(ot866[che-7::TagRFP]) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048568 Caenorhabditis elegans che-7(ot866[che-7::TagRFP]) V. Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"tagRFP inserted into endogenous che-7 locus." WBGene00000488(che-7) WBGene00000488(che-7) WB-STRAIN:WBStrain00048568 WormBase (WB) WB available PMID:32356725 CGC_OH16372 2026-09-05 04:56:30 0
swsn-4(he268 he272 [LoxN start + LoxN intron 5]) IV; heSi208 V; heSi141 X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00048602 Caenorhabditis elegans swsn-4(he268 he272 [LoxN start + LoxN intron 5]) IV; heSi208 V; heSi141 X. Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. Egg laying defective. LoxN sites in the endogenous swsn-4 locus facilitate inducible knockout of swsn-4. he268 he272 homozygotes are Egl since they cannot form a functioning vulva due to swsn-4 inactivated in the mesoderm lineage by hlh-8p::CRE expression. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730" WBGene00004204(swsn-4) WBGene00004204(swsn-4) WB-STRAIN:WBStrain00048602 WormBase (WB) WB unknown PMID:32494730 2026-09-05 04:56:30 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.