Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00048588
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33357442
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048588 Copy
http://www.wormbase.org/db/get?name=WBStrain00048621
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32494730
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048621 Copy
http://www.wormbase.org/db/get?name=WBStrain00048589
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33357442
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048589 Copy
http://www.wormbase.org/db/get?name=WBStrain00048623
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32494730
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048623 Copy
http://www.wormbase.org/db/get?name=WBStrain00048624
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32494730
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048624 Copy
http://www.wormbase.org/db/get?name=WBStrain00048625
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32494730
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048625 Copy
http://www.wormbase.org/db/get?name=WBStrain00048560
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33238119
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048560 Copy
http://www.wormbase.org/db/get?name=WBStrain00048562
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32600387
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048562 Copy
http://www.wormbase.org/db/get?name=WBStrain00048552
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33658510
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048552 Copy
http://www.wormbase.org/db/get?name=WBStrain00048554
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32149606, PMID:38450962
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"WBStrain provided so WBPaper00061495 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00048554 Copy
http://www.wormbase.org/db/get?name=WBStrain00048555
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32149606
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048555 Copy
http://www.wormbase.org/db/get?name=WBStrain00048558
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33238119
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048558 Copy
http://www.wormbase.org/db/get?name=WBStrain00048571
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33674585, PMID:40118018
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048571 Copy
http://www.wormbase.org/db/get?name=WBStrain00048573
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33674585
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048573 Copy
http://www.wormbase.org/db/get?name=WBStrain00048604
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32494730
Synonyms: EMPTY
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.
Proper citation: RRID:WB-STRAIN:WBStrain00048604 Copy
http://www.wormbase.org/db/get?name=WBStrain00048606
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:32494730
Synonyms: swsn-8(he273 he287 [LoxN exon 3 + LoxN last intron]) I; heSi208 V; heSi141 X.
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. he273 he287 homozygotes are Egl since they cannot form a functioning vulva due to swsn-8 inactivated in the mesoderm lineage by hlh-8p::CRE expression. LoxN sites in the endogenous swsn-8 locus facilitate inducible knockout of swsn-8. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730"
Proper citation: RRID:WB-STRAIN:WBStrain00048606 Copy
http://www.wormbase.org/db/get?name=WBStrain00048564
Source Database: WormBase (WB)
Affected Genes: WBGene00003161(mdf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00003161(mdf-2), WBGene00006843(unc-119)
Availability: available
Source References: PMID:31588029
Synonyms: unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V).
Alternate IDs: CGC_OD2174
Notes: CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain."
Proper citation: RRID:WB-STRAIN:WBStrain00048564 Copy
http://www.wormbase.org/db/get?name=WBStrain00048566
Source Database: WormBase (WB)
Affected Genes: WBGene00000868(cyb-3)
Genomic Alteration: WBGene00000868(cyb-3)
Availability: available
Source References: PMID:31588029
Synonyms: cyb-3(lt110) V/nT1 [qIs51] (IV;V).
Alternate IDs: CGC_OD3737
Notes: CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.|"Generated from papers flagged positive during the last month for data type afp_strain/other_strain."
Proper citation: RRID:WB-STRAIN:WBStrain00048566 Copy
http://www.wormbase.org/db/get?name=WBStrain00048568
Source Database: WormBase (WB)
Affected Genes: WBGene00000488(che-7)
Genomic Alteration: WBGene00000488(che-7)
Availability: available
Source References: PMID:32356725
Synonyms: che-7(ot866[che-7::TagRFP]) V.
Alternate IDs: CGC_OH16372
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"tagRFP inserted into endogenous che-7 locus."
Proper citation: RRID:WB-STRAIN:WBStrain00048568 Copy
http://www.wormbase.org/db/get?name=WBStrain00048602
Source Database: WormBase (WB)
Affected Genes: WBGene00004204(swsn-4)
Genomic Alteration: WBGene00004204(swsn-4)
Availability: unknown
Source References: PMID:32494730
Synonyms: swsn-4(he268 he272 [LoxN start + LoxN intron 5]) IV; heSi208 V; heSi141 X.
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. Egg laying defective. LoxN sites in the endogenous swsn-4 locus facilitate inducible knockout of swsn-4. he268 he272 homozygotes are Egl since they cannot form a functioning vulva due to swsn-4 inactivated in the mesoderm lineage by hlh-8p::CRE expression. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730"
Proper citation: RRID:WB-STRAIN:WBStrain00048602 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
