Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
wrm-1(st12263[wrm-1::TY1::EGFP::3xFLAG]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051012 Caenorhabditis elegans wrm-1(st12263[wrm-1::TY1::EGFP::3xFLAG]) III. CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: DKV/LS/CK" WBGene00006943(wrm-1) WBGene00006943(wrm-1) WB-STRAIN:WBStrain00051012 WormBase (WB) WB unknown 2026-09-05 04:57:04 0
col-88(sy1512) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050965 Caenorhabditis elegans col-88(sy1512) III. Made_by: Heenam Park/Mandy Tan/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: CTATCCTTATCGGTACCCAGGTGATCCTCTCCACCGright flanking sequence: CTATCCTTGGCTCCCTGCTCTACGCCGGTGTCCTCinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGGGAGCCAAGGATAGCGGMethod Reference: G3 (Bethesda)." WBGene00000663(col-88) WBGene00000663(col-88) WB-STRAIN:WBStrain00050965 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
tbx-37(st12282[tbx-37::TY1::EGFP::3xFLAG]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051019 Caenorhabditis elegans tbx-37(st12282[tbx-37::TY1::EGFP::3xFLAG]) III. CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: DKV/LS/CK" WBGene00006556(tbx-37) WBGene00006556(tbx-37) WB-STRAIN:WBStrain00051019 WormBase (WB) WB unknown 2026-09-05 04:57:04 0
Y75B8A.6(st12275[Y75B8A.6::TY1::EGFP::3xFLAG]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051017 Caenorhabditis elegans Y75B8A.6(st12275[Y75B8A.6::TY1::EGFP::3xFLAG]) III. CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: DKV/LS/CK" WB-STRAIN:WBStrain00051017 WormBase (WB) WB unknown 2026-09-05 04:57:04 0
col-120(sy1526) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050969 Caenorhabditis elegans col-120(sy1526) IV. Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-120. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: CTTCTGGAATCATGTGCATTATTCTAATTCCTGGGright flanking sequence: CTTTACACATATCTACAATATATTCAAAGCTCTGinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTAGATATGTGTAAAGCCCMethod Reference: G3 (Bethesda)."|"Supplementary_genotype col-120(sy1526)" WBGene00000694(col-120) WBGene00000694(col-120) WB-STRAIN:WBStrain00050969 WormBase (WB) WB unknown PMID:37541249 2026-09-05 04:57:03 0
col-81(sy1520) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050967 Caenorhabditis elegans col-81(sy1520) II. Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-81. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: caaatatccctctcaattccagCATCGCCGCCGCTCright flanking sequence: TCATCGCTGTCATCGCCATCCCAGCCTTCTACAGCinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGCGATGACAGCGATGAGAGMethod Reference: G3 (Bethesda)."|"Supplementary_genotype col-81(sy1520)" WBGene00000657(col-81) WBGene00000657(col-81) WB-STRAIN:WBStrain00050967 WormBase (WB) WB unknown PMID:37541249 2026-09-05 04:57:03 0
ZK637.2(sy1518) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050966 Caenorhabditis elegans ZK637.2(sy1518) III. Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZK637.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: CGATGAGATGATTGACGATTTGGATAAGACCTATTright flanking sequence: TGAGGGATATGCAGAAGAGCATGTTTCAGTGCTCAGinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTCTGCATATCCCTCAAATMethod Reference: G3 (Bethesda)." WBGene00014022(famh-136) WBGene00014022(famh-136) WB-STRAIN:WBStrain00050966 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
msp-3(sy1594) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051000 Caenorhabditis elegans msp-3(sy1594) II. Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTTTTGGACCCAAAGGAAGCTGTGCTTCTTGCCGTGTRight flanking sequence: CATGCGATGCCTTCGCCTTCGGACAGGAGGACACinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGCGAAGGCATCGCATGACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" WBGene00003424(msp-3) WBGene00003424(msp-3) WB-STRAIN:WBStrain00051000 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
mab-9(st12257[mab-9::TY1::EGFP::3xFLAG]) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051009 Caenorhabditis elegans mab-9(st12257[mab-9::TY1::EGFP::3xFLAG]) II. CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: DKV/LS/CK" WBGene00003106(mab-9) WBGene00003106(mab-9) WB-STRAIN:WBStrain00051009 WormBase (WB) WB unknown 2026-09-05 04:57:04 0
lgc-30(sy1486) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050952 Caenorhabditis elegans lgc-30(sy1486) IV. Made_by: Heenam Park/Mandy Tan/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-30. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GCTTCATCCCGAAAAAACTAATAAAAAAGCCGCCGright flanking sequence: GCTATCGACGACACGGCGTTTCATCGGCGTCGAGCinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCGTGTCGTCGATAGCCGGMethod Reference: G3 (Bethesda)." WBGene00019069(lgc-30) WBGene00019069(lgc-30) WB-STRAIN:WBStrain00050952 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
lgc-32(sy1483) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050951 Caenorhabditis elegans lgc-32(sy1483) X. Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-32. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GATTGCACAAGTGATGAAGATGTGATTGCTGATCTright flanking sequence: CTTAGGAAGAAATTCACATTCTTCTGgtaacttattginserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GATGTGATTGCTGATCTCTTMethod Reference: G3 (Bethesda)." WBGene00020569(lgc-32) WBGene00020569(lgc-32) WB-STRAIN:WBStrain00050951 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
lgc-44(sy1500) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050958 Caenorhabditis elegans lgc-44(sy1500) V. Made_by: Heenam Park/Mandy Tan/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: CTCTATTTCTCTTCTTTTTCTAATATTTCCACATright flanking sequence: TCATCTAATCCTTCAAGCTCTAATTTTCTGGATATTGinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTGAAGGATTAGATGAATGMethod Reference: G3 (Bethesda)." WBGene00009790(lgc-44) WBGene00009790(lgc-44) WB-STRAIN:WBStrain00050958 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
lgc-16(sy1467) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050943 Caenorhabditis elegans lgc-16(sy1467) X. Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTCACATTATTTTCATTTTCTGACATTTCCGCATRight flanking sequence: TTTATCATGATCCAGGATTATATGgtaaagtttgginserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCTGGATCATGATAAAATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" WBGene00011358(lgc-16) WBGene00011358(lgc-16) WB-STRAIN:WBStrain00050943 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
nlp-73(sy1465) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050942 Caenorhabditis elegans nlp-73(sy1465) V. Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-73. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GGTGCTCATCGCGACCACTGTGCTCATCGCCGAGTright flanking sequence: CTCGTGTATTCTATAACCGATTCGACGGCGGGCTCinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATAGAATACACGAGACTMethod Reference: G3 (Bethesda)." WB-STRAIN:WBStrain00050942 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
lgc-24(sy1475) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050947 Caenorhabditis elegans lgc-24(sy1475) X. Made_by: Heenam Park/Mandy Tan/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-24. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GGTGTCACAATGGGAAACGGGAAAAAGCTTCACGGright flanking sequence: TTTTGgtgagttttatttttcatatgttgattattaginserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGGAAAAAGCTTCACGGTTTMethod Reference: G3 (Bethesda)." WBGene00045385(lgc-24) WBGene00045385(lgc-24) WB-STRAIN:WBStrain00050947 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
lgc-18(sy1469) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050944 Caenorhabditis elegans lgc-18(sy1469) X. Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-18. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: gtttttattcaaaatgttaattcttcattttgcagTTCCGright flanking sequence: GAATGGAACAATTTCTTGGAGAATCAAGTTAAACinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCATTTTGCAGTTCCGGAAMethod Reference: G3 (Bethesda)." WBGene00011360(lgc-18) WBGene00011360(lgc-18) WB-STRAIN:WBStrain00050944 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
lgc-21(sy1477) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050948 Caenorhabditis elegans lgc-21(sy1477) X. Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-21. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: CGGCATTTGCTCTAGGCCAAGAGCAGAACCAAGCright flanking sequence: CGGTACCGCGGTTGCCGGGCCCCATATCGTCAACTCinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGGCAACCGCGGTACCGGCTMethod Reference: G3 (Bethesda)." WBGene00007903(lgc-21) WBGene00007903(lgc-21) WB-STRAIN:WBStrain00050948 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
nlp-19(sy1457) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050938 Caenorhabditis elegans nlp-19(sy1457) X. Made_by: Heenam Park/Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: ctctactgttgtatattcttcttcacaATGCTCTTright flanking sequence: ACGCGGTGTATGCCTTGCTCTTCTCATTCTAGTCACinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTTCACAATGCTCTTACGMethod Reference: G3 (Bethesda)." WBGene00003757(nlp-19) WBGene00003757(nlp-19) WB-STRAIN:WBStrain00050938 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
dmsr-16(sy1565) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050990 Caenorhabditis elegans dmsr-16(sy1565) V. Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTTTTAAGTTTCTTTGCAAATGCTCTTATCGCTATAG Right flanking sequence: TTCTGGCAAACAAGGTTATGAGGATTTCTGGAACinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGCTCTTATCGCTATAGTTCMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" WBGene00194821(dmsr-16) WBGene00194821(dmsr-16) WB-STRAIN:WBStrain00050990 WormBase (WB) WB unknown 2026-09-05 04:57:03 0
otpl-3(sy1583) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00050994 Caenorhabditis elegans otpl-3(sy1583) X. Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CTTCGTCAAATTGTTCTACAATTGCAACACCCAACRight flanking sequence: AGCAAAGTCAGATTTCGGTATCATGAGAAACGATATTGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAAATCTGACTTTGCTGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" WBGene00017449(otpl-3) WBGene00017449(otpl-3) WB-STRAIN:WBStrain00050994 WormBase (WB) WB unknown 2026-09-05 04:57:03 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.