Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 102 showing 2021 ~ 2040 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00035541

http://www.wormbase.org/db/get?name=WBStrain00035541

Source Database: WormBase (WB)
Affected Genes: WBGene00003980(pes-7)
Genomic Alteration: WBGene00003980(pes-7)
Availability: available
Source References: EMPTY
Synonyms: pes-7(gk123) I.
Alternate IDs: WB-STRAIN:VC145, CGC_VC145
Notes: F09C3.1. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035541 Copy   


  • RRID:WB-STRAIN:WBStrain00035551

http://www.wormbase.org/db/get?name=WBStrain00035551

Source Database: WormBase (WB)
Affected Genes: WBGene00004092(ppt-1)
Genomic Alteration: WBGene00004092(ppt-1)
Availability: available
Source References: EMPTY
Synonyms: ppt-1(gk131) V.
Alternate IDs: WB-STRAIN:VC166, CGC_VC166
Notes: F44C4.5. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035551 Copy   


  • RRID:WB-STRAIN:WBStrain00035550

http://www.wormbase.org/db/get?name=WBStrain00035550

Source Database: WormBase (WB)
Affected Genes: WBGene00006436(ttn-1)
Genomic Alteration: WBGene00006436(ttn-1)
Availability: available
Source References: EMPTY
Synonyms: ttn-1(gk135) V.
Alternate IDs: WB-STRAIN:VC165, CGC_VC165
Notes: H05O09.1 W06H8.8 Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035550 Copy   


  • RRID:WB-STRAIN:WBStrain00035553

http://www.wormbase.org/db/get?name=WBStrain00035553

Source Database: WormBase (WB)
Affected Genes: WBGene00004092(ppt-1)
Genomic Alteration: WBGene00004092(ppt-1)
Availability: available
Source References: EMPTY
Synonyms: ppt-1(gk134) V.
Alternate IDs: WB-STRAIN:VC168, CGC_VC168
Notes: F44C4.5. Dpyish.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035553 Copy   


  • RRID:WB-STRAIN:WBStrain00035555

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035555

Source Database: WormBase (WB)
Affected Genes: WBGene00000516(cki-1)|WBGene00001072(dpy-10)
Genomic Alteration: WBGene00000516(cki-1), WBGene00001072(dpy-10)
Availability: available
Source References: PMID:38522217
Synonyms: cki-1(gk132)/mIn1 II
Alternate IDs: WB-STRAIN:VC170, CGC_VC170
Notes: Mutagen:UV/TMP|"T05A6.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk132 homozygotes (embryonic arrest). Pick WT and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035555 Copy   


  • RRID:WB-STRAIN:WBStrain00035554

http://www.wormbase.org/db/get?name=WBStrain00035554

Source Database: WormBase (WB)
Affected Genes: WBGene00006537(tbb-2)
Genomic Alteration: WBGene00006537(tbb-2)
Availability: available
Source References: EMPTY
Synonyms: tbb-2(gk129) III.
Alternate IDs: WB-STRAIN:VC169, CGC_VC169
Notes: C36E8.5. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035554 Copy   


  • RRID:WB-STRAIN:WBStrain00035557

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035557

Source Database: WormBase (WB)
Affected Genes: WBGene00000467(cep-1)
Genomic Alteration: WBGene00000467(cep-1)
Availability: available
Source References: PMID:31704915, PMID:33262405
Synonyms: cep-1(gk138) I.
Alternate IDs: WB-STRAIN:VC172, CGC_VC172
Notes: F52B5.5. Superficially wild type.|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00060693 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035557 Copy   


  • RRID:WB-STRAIN:WBStrain00035556

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035556

Source Database: WormBase (WB)
Affected Genes: WBGene00004877(smf-2)
Genomic Alteration: WBGene00004877(smf-2)
Availability: available
Source References: EMPTY
Synonyms: smf-2(gk133) X.
Alternate IDs: WB-STRAIN:VC171, CGC_VC171
Notes: K11G12.3. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035556 Copy   


  • RRID:WB-STRAIN:WBStrain00035560

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035560

Source Database: WormBase (WB)
Affected Genes: WBGene00004933(sod-4)
Genomic Alteration: WBGene00004933(sod-4)
Availability: available
Source References: EMPTY
Synonyms: sod-4(gk101) III.
Alternate IDs: WB-STRAIN:VC175, CGC_VC175
Notes: F55H2.1. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035560 Copy   


  • RRID:WB-STRAIN:WBStrain00035525

http://www.wormbase.org/db/get?name=WBStrain00035525

Source Database: WormBase (WB)
Affected Genes: WBGene00003474(mtl-2)
Genomic Alteration: WBGene00003474(mtl-2)
Availability: available
Source References: PMID:38790689
Synonyms: mtl-2(gk125) V.
Alternate IDs: WB-STRAIN:VC128, CGC_VC128
Notes: Mutagen:UV/TMP|"T08G5.10. Superficially wild type."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035525 Copy   


  • RRID:WB-STRAIN:WBStrain00035529

http://www.wormbase.org/db/get?name=WBStrain00035529

Source Database: WormBase (WB)
Affected Genes: WBGene00015485(fhip-1)
Genomic Alteration: WBGene00015485(fhip-1)
Availability: available
Source References: EMPTY
Synonyms: C05D11.8(gk47) III.
Alternate IDs: WB-STRAIN:VC133, CGC_VC133
Notes: C05D11.8. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035529 Copy   


  • RRID:WB-STRAIN:WBStrain00035520

http://www.wormbase.org/db/get?name=WBStrain00035520

Source Database: WormBase (WB)
Affected Genes: WBGene00001817(haf-7)
Genomic Alteration: WBGene00001817(haf-7)
Availability: available
Source References: EMPTY
Synonyms: haf-7(gk46) V.
Alternate IDs: WB-STRAIN:VC118, CGC_VC118
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y50E8A.16. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00035520 Copy   


  • RRID:WB-STRAIN:WBStrain00035522

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035522

Source Database: WormBase (WB)
Affected Genes: WBGene00006475(tyra-3)
Genomic Alteration: WBGene00006475(tyra-3)
Availability: available
Source References: PMID:32847964, PMID:37728328, PMID:37773959
Synonyms: tyra-3(ok325) X.
Alternate IDs: WB-STRAIN:VC125, CGC_VC125
Notes: M03F4.3. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"Supplementary_genotype tyra-3(ok325)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00060134 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00035522 Copy   


  • RRID:WB-STRAIN:WBStrain00035521

http://www.wormbase.org/db/get?name=WBStrain00035521

Source Database: WormBase (WB)
Affected Genes: WBGene00004207(ptb-1)
Genomic Alteration: WBGene00004207(ptb-1)
Availability: available
Source References: EMPTY
Synonyms: ptb-1(gk113) II.
Alternate IDs: WB-STRAIN:VC119, CGC_VC119
Notes: D2089.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035521 Copy   


  • RRID:WB-STRAIN:WBStrain00035537

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035537

Source Database: WormBase (WB)
Affected Genes: WBGene00006977(zif-1)
Genomic Alteration: WBGene00006977(zif-1)
Availability: available
Source References: EMPTY
Synonyms: zif-1(gk117) III.
Alternate IDs: WB-STRAIN:VC141, CGC_VC141
Notes: F59B2.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035537 Copy   


  • RRID:WB-STRAIN:WBStrain00035536

http://www.wormbase.org/db/get?name=WBStrain00035536

Source Database: WormBase (WB)
Affected Genes: WBGene00001233(eif-3.K)
Genomic Alteration: WBGene00001233(eif-3.K)
Availability: available
Source References: EMPTY
Synonyms: eif-3.K(gk126) V.
Alternate IDs: WB-STRAIN:VC140, CGC_VC140
Notes: Mutagen:UV/TMP|"T16G1.11. Superficially wild type."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035536 Copy   


  • RRID:WB-STRAIN:WBStrain00035538

http://www.wormbase.org/db/get?name=WBStrain00035538

Source Database: WormBase (WB)
Affected Genes: WBGene00000959(dgk-2)
Genomic Alteration: WBGene00000959(dgk-2)
Availability: available
Source References: EMPTY
Synonyms: dgk-2(gk124) X.
Alternate IDs: WB-STRAIN:VC142, CGC_VC142
Notes: F46H6.2. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035538 Copy   


  • RRID:WB-STRAIN:WBStrain00035531

http://www.wormbase.org/db/get?name=WBStrain00035531

Source Database: WormBase (WB)
Affected Genes: WBGene00006399(tag-4)
Genomic Alteration: WBGene00006399(tag-4)
Availability: available
Source References: EMPTY
Synonyms: tag-4(gk128) I.
Alternate IDs: WB-STRAIN:VC135, CGC_VC135
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK337.4. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00035531 Copy   


  • RRID:WB-STRAIN:WBStrain00035534

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035534

Source Database: WormBase (WB)
Affected Genes: WBGene00001239(elo-1)
Genomic Alteration: WBGene00001239(elo-1)
Availability: available
Source References: EMPTY
Synonyms: elo-1(gk48) IV.
Alternate IDs: WB-STRAIN:VC138, CGC_VC138
Notes: F56H1.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035534 Copy   


  • RRID:WB-STRAIN:WBStrain00035508

http://www.wormbase.org/db/get?name=WBStrain00035508

Source Database: WormBase (WB)
Affected Genes: WBGene00006836(unc-112)
Genomic Alteration: WBGene00006836(unc-112)
Availability: available
Source References: EMPTY
Synonyms: unc-112(r367) V; gkDf2 X.
Alternate IDs: WB-STRAIN:VC100, CGC_VC100
Notes: gkDf2. Multiple genes deleted. Deletion extents determined by oligo array CGH. Deletion size: ~44kb. Deletion left flank: TTAGTAAGCCGGAAAATGGATTTCGCTTTTCTCCTATTGAGAAACCTAAA. Deletion right flank: CTACCTTTCAAAATGAATAGCAACCACTTTTTCGACGAAGAAATGTTCGT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035508 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X