Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pREDIA Resource Report Resource Website |
RRID:Addgene_51625 | I-SceI | Saccharomyces cerevisiae | Ampicillin | PMID:24747889 | Backbone Size:6300; Vector Backbone:pKD46; Vector Types:Bacterial Expression, Red recombinase and I-SceI endonuclease; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:15 | 0 | ||
|
pME-Gal80 Resource Report Resource Website |
RRID:Addgene_51620 | Gal80 | Saccharomyces cerevisiae | Kanamycin | PMID:21905164 | pME-Gal80 was cloned by PCR from TubP-GAL80 (Lee and Luo, 1999; obtained from Addgene, plasmid #17748) using primers 5'-ATGGACTACAACAAGAGATCTTCG-3' and 5'-TTATAAACTATAATGCGAGATATTGCT-3'. | Vector Backbone:Gateway middle entry clone (pME); Vector Types:vertebrate expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:15 | 0 | |
|
pREDTKI Resource Report Resource Website 1+ mentions |
RRID:Addgene_51628 | I-SceI | Saccharomyces cerevisiae | Kanamycin | PMID:24747889 | Backbone Size:6300; Vector Backbone:pKD46; Vector Types:Bacterial Expression, Red recombinase and I-SceI endonuclease; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:15 | 3 | ||
|
M2371 his3::ADE2 Disruptor Converter Resource Report Resource Website |
RRID:Addgene_51671 | ADE2 | Saccharomyces cerevisiae | Ampicillin | PMID:12898713 | Plasmid was made by cutting pJJ215 with MscI and Nsi I and replacing the 570 bp MscI–Nsi I fragment with a 3.6 kb NotI (blunted with Klenow)–PstI fragment containing ADE2 from plasmid M1144. Plasmid M1144 contains a 3.6 kb BglII fragment (partial digest product) with ADE2 with BamHI linkers cloned into the BamHI site of Bluescript KS+. | Vector Backbone:pJJ215; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:16 | 0 | |
|
M3499 ura3::ADE2 Disruptor Converter Resource Report Resource Website 1+ mentions |
RRID:Addgene_51674 | ADE2 | Saccharomyces cerevisiae | Ampicillin | PMID:12898713 | Plasmid M3499 (ura3::ADE2 ) was made by cutting pJJ244 with StuI and EcoRV and replacing the 248 bp StuI–EcoRV fragment with a 3.6 kb BamHI blunted with Klenow) fragment containing ADE2 from plasmid M1144. | Vector Backbone:pJJ244; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:16 | 1 | |
|
D1433 his3::LYS2 Disruptor Converter Resource Report Resource Website |
RRID:Addgene_51676 | LYS2 | Saccharomyces cerevisiae | Ampicillin | PMID:12898713 | Plasmid was made by cutting YDp-H with BglII and replacing the 60 bp BglII fragment with a 5 kb BamHI fragment (partial digest product) containing LYS2 from plasmid YDp-K. | Vector Backbone:YDp-H; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:16 | 0 | |
|
M2660 ura3::LYS2 Disruptor Converter Resource Report Resource Website |
RRID:Addgene_51678 | LYS2 | Saccharomyces cerevisiae | Ampicillin | PMID:12898713 | Plasmid M2660 (ura3::LYS2 ) was made by cutting M581 with EcoRV and PstI and replacing the 208 bp EcoRV–PstI fragment with a 4.6 kb PvuII–PstI fragment containing LYS2 from plasmid YDp-K. | Backbone Marker:Marsh et al., 1984; Vector Backbone:M581; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:20 | 0 | |
|
M4755 KanMX::LEU2 Disruptor Converter Resource Report Resource Website |
RRID:Addgene_51685 | LEU2 | Saccharomyces cerevisiae | Ampicillin | PMID:12898713 | M4756 (kanMX::LEU2)was made by digesting M4757 with BamHI and SphI and inserting a 2.0 kb BamHI–SphI fragment with LEU2 from plasmid pJJ250. | Vector Backbone:M4757 (kanMX::TRP1), Addgene plasmid #51687; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:16 | 0 | |
|
pCDNA3-ySet2 Resource Report Resource Website |
RRID:Addgene_51698 | yeast Set2 | Saccharomyces cerevisiae | Ampicillin | PMID:20133523 | Backbone Marker:commercial; Backbone Size:5400; Vector Backbone:pcDNA3.1 +; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:16 | 0 | ||
|
p413TEF-Sir2 Resource Report Resource Website |
RRID:Addgene_51742 | Sir2 | Saccharomyces cerevisiae | Ampicillin | PMID:19390637 | Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:20 | 0 | ||
|
pKF257 Resource Report Resource Website |
RRID:Addgene_52533 | I-SceI | Saccharomyces cerevisiae | Ampicillin | PMID:24748663 | Backbone Size:10877; Vector Backbone:pCASPER5; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:24 | 0 | ||
|
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB Resource Report Resource Website 1+ mentions |
RRID:Addgene_52889 | Gal4 | Saccharomyces cerevisiae | Ampicillin | PMID:25605786 | Backbone Marker:David Strutt (Brittle et al., 2010); Vector Backbone:pAct5-FRT-stop-FRT-SV40polyA attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 3 | ||
|
pTK93_Lifeact-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_46357 | Lifeact | Saccharomyces cerevisiae | Ampicillin | PMID:23870127 | Backbone Size:5000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:31 | 9 | ||
|
pSNR52-sgTET Resource Report Resource Website |
RRID:Addgene_46923 | sgRNA targeting endogenous TRE elements of pTET07 promoter | Saccharomyces cerevisiae | Ampicillin | PMID:23849981 | gRNA target sequence TATCAGTGATAGAGAAAAGT | Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 0 | |
|
pJBEI-6410 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47049 | Codon-optimized sequences for MEV pathway expression in E. coli to produce limonene | Saccharomyces cerevisiae | Ampicillin | PMID:23727191 | The R364S mutation in the MK is not known to alter the function. The plasmid functions as described in the associated publication. | Backbone Size:3500; Vector Backbone:pBbA5a; Vector Types:Bacterial Expression, Synthetic Biology, BglBrick; Bacterial Resistance:Ampicillin | R364S mutation in MK | 2026-08-15 01:15:37 | 2 |
|
pDR-meptrac-H194E Resource Report Resource Website |
RRID:Addgene_47764 | MepTrac-H194E | Saccharomyces cerevisiae | Ampicillin | PMID:23840931 | Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | H194E | 2026-08-15 01:15:44 | 0 | |
|
pDR-meptrac Resource Report Resource Website |
RRID:Addgene_47768 | meptrac | Saccharomyces cerevisiae | Ampicillin | PMID:23840931 | Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:45 | 0 | ||
|
pFA6a-kanMX6-PGAL1-GFP (F64L, S65T, V163A) Resource Report Resource Website 1+ mentions |
RRID:Addgene_53205 | GAL1 promoter | Saccharomyces cerevisiae | Ampicillin | GFP in Addgene plasmid #41614 was replaced with stable GFP variant (F64L, S65T, V163A). | Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:32 | 1 | ||
|
pFA6a-GFP (F64L, S65T, V163A)-TRP1 Resource Report Resource Website |
RRID:Addgene_53184 | TRP1 | Saccharomyces cerevisiae | Ampicillin | PMID:17942599 | This plasmid is similar to Addgene plasmid #41597, except the GFP has been switched to a more stable variant. | Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:28 | 0 | |
|
pFA6a-GFP (F64L, S65T, V163A)-His3MX6 Resource Report Resource Website |
RRID:Addgene_53185 | HIs3MX6 | Saccharomyces cerevisiae | Ampicillin | PMID:17942599 | This plasmid is similar to Addgene plasmid #41598, except the GFP has been switched to a more stable variant. | Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:28 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
