Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,553 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
hUbc13
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51131 ubc13 Homo sapiens Ampicillin PMID:22367539 Backbone Marker:Novagen; Backbone Size:5800; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:14 4
Cin85-3SH3-pCMV6-AN-GFP
 
Resource Report
Resource Website 		RRID:Addgene_51137 Cin85 Homo sapiens Ampicillin Backbone Marker:Origene; Backbone Size:6600; Vector Backbone:pCMV6-AN-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contains 3 SH3 domains 2026-08-15 01:16:11 0
pSLQ1661-sgMUC4-E3(F+E)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51025 optimized sgRNA Homo sapiens Ampicillin PMID:24360272 gRNA target sequence GTGGCGTGACCTGTGGATGCTG Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:13 8
pSLQ1651-sgTelomere(F+E)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_51024 Optimized sgRNA Homo sapiens Ampicillin PMID:24360272 gRNA target sequence GTTAGGGTTAGGGTTAGGGTTA Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 18
pCMV-N2-6MYC-hMID2
 
Resource Report
Resource Website 		RRID:Addgene_51035 MID2 Homo sapiens Kanamycin PMID:11806752 Please note: hMID2 begins at residue 19 of the NCBI reference sequence. Backbone Marker:Cox lab; Vector Backbone:pCMV-N2-6Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:10 0
pLA CMV N-HA RALB WT
 
Resource Report
Resource Website 		RRID:Addgene_50989 RALB Homo sapiens Ampicillin PMID:24056301 Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:16:13 0
pLA CMV N-Flag RALB V23 R47
 
Resource Report
Resource Website 		RRID:Addgene_50983 RALB Homo sapiens Ampicillin PMID:24056301 Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin G23V, K47R 2026-08-15 01:16:10 0
pLA CMV N-Flag RALB V23 R160
 
Resource Report
Resource Website 		RRID:Addgene_50982 RALB Homo sapiens Ampicillin PMID:24056301 Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin G23V K160R 2026-08-15 01:16:10 0
Human Lentiviral sgRNA Library - Ribosomal Proteins
 
Resource Report
Resource Website 		RRID:Addgene_51045 sgRNA library (enriched for ribosomal targets) Homo sapiens Ampicillin PMID:24336569 The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below. Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
Human Lentiviral sgRNA Library - Kinases
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51044 sgRNA library (enriched for kinase targets) Homo sapiens Ampicillin PMID:24336569 The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below. Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:13 4
Human Lentiviral sgRNA Library - Nuclear
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51047 sgRNA library (enriched for nuclear targets) Homo sapiens Ampicillin PMID:24336569 The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below. Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:13 8
Human Lentiviral sgRNA Library - Unknown Function
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51043 sgRNA library (enriched for genes of unknown function) Homo sapiens Ampicillin PMID:24336569 The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below. Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 2
pBABEpuro-ARAF_S214F
 
Resource Report
Resource Website 		RRID:Addgene_51078 ARAF Homo sapiens Ampicillin PMID:24569458 Backbone Size:5200; Vector Backbone:pBABEpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin S214F 2026-08-15 01:16:11 0
pH2B-EYFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51002 H2B-EYFP Homo sapiens Kanamycin Please note that the H2B sequence in this plasmid was derived from H2B-GFP (Addgene plasmid# 11680) and contains the same differences (D26G and V119I) compared to GenBank reference sequences, such as NP_066402.2. Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:13 2
pBABEpuro-CRAF_S257W
 
Resource Report
Resource Website 		RRID:Addgene_51126 CRAF Homo sapiens Ampicillin Backbone Size:5200; Vector Backbone:pBABEpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin S257W 2026-08-15 01:16:11 0
pLenti.Syn(0.5).H2B-eGFP.W
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51004 H2B-EGFP Homo sapiens Ampicillin Please note that the H2B sequence in this plasmid was derived from H2B-GFP (Addgene plasmid# 11680) and contains the same differences (D26G and V119I) compared to GenBank reference sequences, such as NP_066402.2. Backbone Size:8344; Vector Backbone:pLenti.Syn(0.5).eGFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 2
pBABEpuro-CRAF_S259A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51127 CRAF Homo sapiens Ampicillin Backbone Size:5200; Vector Backbone:pBABEpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin S259A 2026-08-15 01:16:11 1
pINDUCER21-HOXA9
 
Resource Report
Resource Website 		RRID:Addgene_51302 homeobox A9 Homo sapiens Ampicillin PMID:24094326 NOTE: The map and depositor sequence are of the empty backbone ONLY. Addgene does not have sequence for the fully assembled plasmid. Sequence for much of the insert can be found in Addgene's sequencing results. Backbone Marker:Dr. Richard Mulligan; Backbone Size:12152; Vector Backbone:pINDUCER21 (ORF-EG); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin n/a 2026-08-15 01:16:12 0
pINDUCER21-ERG
 
Resource Report
Resource Website 		RRID:Addgene_51301 v-ets avian erythroblastosis virus E26 oncogene homolog Homo sapiens Ampicillin PMID:24094326 NOTE: The map and depositor sequence are of the empty backbone ONLY. Addgene does not have sequence for the fully assembled plasmid. Sequence for much of the insert can be found in Addgene's sequencing results. Backbone Marker:Dr. Richard Mulligan; Backbone Size:12152; Vector Backbone:pINDUCER21 (ORF-EG); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin full length ORF 2026-08-15 01:16:15 0
pmRFP-N1 human cofilin R21Q
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51279 cofilin 1 Homo sapiens Kanamycin PMID:24391794 This cofilin plasmid contains some silent mutations to make it resistant to an siRNA used in the Bamburg lab. The mutations change the wildtype sequence (AAG TCT TCA ACG CCA GAG GAG) into AAG AGC TCA ACC CCA GAG GAG. Backbone Marker:R.Y. Tsien, PNAS 2002 v99 pp7877–7882; Vector Backbone:pmRFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin R21Q, non-rod-forming mutation that can be used to track cofilin-actin rods in vivo without causing cofilin overexpression artifacts 2026-08-15 01:16:12 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch