Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:bleocin (zeocin) (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

566 Results - per page

Show More Columns | Download 566 Result(s)

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pBudORF2-CH
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_51289 L1 ORF2 Homo sapiens Bleocin (Zeocin) PMID:21572950 This plasmid was created using the codon optimized L1RP as a source for the ORF2 coding sequence. Backbone Marker:Invitrogen; Backbone Size:4595; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:16:15 2
pCri-15b
 
Resource Report
Resource Website
RRID:Addgene_61336 Green fluorescent protein Bleocin (Zeocin) PMID:25386923 Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:17:41 0
pBoPyV2a-S22
 
Resource Report
Resource Website
RRID:Addgene_62356 Full genome of BoPyV2a isolate S22 Viruses (Polyomaviridae) Bleocin (Zeocin) PMID:25568187 Genome can be liberated by digestion with SacII Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:17:52 0
pBoPyV3-S22
 
Resource Report
Resource Website
RRID:Addgene_62368 Full genome of BoPyV3 isolate S22 Viruses (Polyomaviridae) Bleocin (Zeocin) PMID:25568187 Genome can be liberated by digestion with EcoRI Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:17:52 0
pBoPyV3-S23
 
Resource Report
Resource Website
RRID:Addgene_62369 Full genome of BoPyV3 isolate S23 Viruses (Polyomaviridae) Bleocin (Zeocin) PMID:25568187 Genome can be liberated by digestion with EcoRI Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:17:52 0
pCoofy42
 
Resource Report
Resource Website
RRID:Addgene_55190 Bleocin (Zeocin) PMID:23410102 C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected. Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:16:47 0
pIZ-Flag6His-BmAgo3
 
Resource Report
Resource Website
RRID:Addgene_50559 BmAgo3 Bombyx mori Bleocin (Zeocin) PMID:19460866 Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:16:07 0
p8RwB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_48733 dsRed-Express Discosoma sp Bleocin (Zeocin) PMID:17603495 This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:15:53 2
pRwB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_48734 dsRed-Express Discosoma sp Bleocin (Zeocin) PMID:19073722 Note that this plasmid is substantially smaller than the ~8kb native papillomavirus genome. There is a second version of this plasmid with a 2kb stuffer region that is available here: http://www.addgene.org/48733 . Further information can be found here: http://home.ccr.cancer.gov/Lco/target.htm Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:15:53 1
M-tdTom-SP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_48677 TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 Synthetic Bleocin (Zeocin) PMID:24076762 Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:15:53 2
C321.ΔA.exp
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_49018 Recoded E. coli with all UAG codons and RF1 removed (UAG termination abolished); decreased mutation rate; 37C growth tolerated E. coli Bleocin (Zeocin) PMID:24136966 E. coli MG1655 Delta(ybhB-bioAB)::zeoR Delta prfA; all 321 UAG codons changed to UAA This strain is mutS+, which causes a normal spontaneous mutation frequency of ~1E-10. This strain is auxotrophic for d-biotin. The genome sequence of a similar strain (C321.deltaA) was deposited at NCBI (accession # CP006698.1). Vector Backbone:E. coli genome; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin) See genbank file 2026-08-15 01:15:55 31
pfwB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37329 GFP Aequorea victoria Bleocin (Zeocin) PMID:15709003 Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:14:14 4
AtPIN1
 
Resource Report
Resource Website
RRID:Addgene_117088 AtPIN1 Arabidopsis thaliana Bleocin (Zeocin) Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:02:50 0
AtPIN2
 
Resource Report
Resource Website
RRID:Addgene_117089 AtPIN2 Arabidopsis thaliana Bleocin (Zeocin) Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:02:50 0
MtPT4-eGFP
 
Resource Report
Resource Website
RRID:Addgene_117095 MtPT4-eGFP Other Bleocin (Zeocin) Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:02:50 0
MtPT4
 
Resource Report
Resource Website
RRID:Addgene_117096 MtPT4 Other Bleocin (Zeocin) Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:02:50 0
AtNPY1
 
Resource Report
Resource Website
RRID:Addgene_117090 AtNPY1 Arabidopsis thaliana Bleocin (Zeocin) Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:02:50 0
SLAC-deltaCdeltaN
 
Resource Report
Resource Website
RRID:Addgene_117103 SLAC-deltaCdeltaN Arabidopsis thaliana Bleocin (Zeocin) Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:02:50 0
SLAC-deltaC
 
Resource Report
Resource Website
RRID:Addgene_117102 SLAC-deltaC Arabidopsis thaliana Bleocin (Zeocin) Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:02:51 0
SLAH3
 
Resource Report
Resource Website
RRID:Addgene_117105 SLAH3 Arabidopsis thaliana Bleocin (Zeocin) Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:02:51 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.