Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Bombyx mori
Genetic Insert: BmAgo3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19460866
Proper citation: RRID:Addgene_50559 Copy
Species: Homo sapiens
Genetic Insert: L1 ORF2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4595; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:21572950
Comments: This plasmid was created using the codon optimized L1RP as a source for the ORF2 coding sequence.
Proper citation: RRID:Addgene_51289 Copy
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene.
Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:
LP1 forward vector primer:
SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'
LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest:
none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3'
10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3'
StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3'
S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3'
HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3'
Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3'
Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.
Proper citation: RRID:Addgene_55190 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61336 Copy
Species: Homo sapiens
Genetic Insert: KCNQ4
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Comments: This is a validated antigen plasmid of Anti-Kv7.4/KCNQ4 K+ channel [N43/6R].
Proper citation: RRID:Addgene_197329 Copy
Species: Homo sapiens
Genetic Insert: Fc2-MFSD8(L9)
Vector Backbone Description: Vector Backbone:pFUSE; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:40132641
Proper citation: RRID:Addgene_239947 Copy
Species: BK polyomavirus
Genetic Insert: BKV-IV VP1
Vector Backbone Description: Backbone Marker:Synthetic; Backbone Size:1766; Vector Backbone:pJailbreak; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Proper citation: RRID:Addgene_240335 Copy
Species: Synthetic
Genetic Insert: AT118-L
Vector Backbone Description: Vector Backbone:pFUSE-CHIg-hG1 ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38744986
Proper citation: RRID:Addgene_222854 Copy
Species: Synthetic
Genetic Insert: AT118-L
Vector Backbone Description: Vector Backbone:pFUSE-CHIg-hG1 ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38744986
Proper citation: RRID:Addgene_222855 Copy
Species: Homo sapiens
Genetic Insert: OPA1
Vector Backbone Description: Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:39222684
Proper citation: RRID:Addgene_227601 Copy
Species: Homo sapiens
Genetic Insert: SLC25A46
Vector Backbone Description: Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:39222684
Proper citation: RRID:Addgene_227606 Copy
Species: Homo sapiens
Genetic Insert: OPA1
Vector Backbone Description: Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:39222684
Proper citation: RRID:Addgene_227600 Copy
Species: Homo sapiens
Genetic Insert: SLC25A46
Vector Backbone Description: Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:39222684
Proper citation: RRID:Addgene_227599 Copy
Species: Homo sapiens
Genetic Insert: MACROD1
Vector Backbone Description: Vector Backbone:pDONRzeo; Vector Types:Gateway Cloning; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:32427867
Proper citation: RRID:Addgene_172572 Copy
Species: Synthetic
Genetic Insert: CD19 CAR mammalian expression cassette
Vector Backbone Description: Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38843831
Proper citation: RRID:Addgene_218332 Copy
Species: Synthetic
Genetic Insert: HER1 CAR mammalian expression cassette
Vector Backbone Description: Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38843831
Proper citation: RRID:Addgene_218335 Copy
Species: Synthetic
Genetic Insert: CD19 CAR mammalian expression cassette
Vector Backbone Description: Vector Backbone: pICOZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38843831
Proper citation: RRID:Addgene_218344 Copy
Species: Synthetic
Genetic Insert: K241R mutant of MAG transposase
Vector Backbone Description: Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38843831
Proper citation: RRID:Addgene_218302 Copy
Species: Homo sapiens
Genetic Insert: SLC25A46
Vector Backbone Description: Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:39222684
Proper citation: RRID:Addgene_227610 Copy
Species: Homo sapiens
Genetic Insert: SLC25A46
Vector Backbone Description: Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:39222684
Proper citation: RRID:Addgene_227611 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.