Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 566 results
Snippet view Table view Download 566 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_51289

    This resource has 1+ mentions.

http://www.addgene.org/51289

Species: Homo sapiens
Genetic Insert: L1 ORF2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4595; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:21572950
Comments: This plasmid was created using the codon optimized L1RP as a source for the ORF2 coding sequence.

Proper citation: RRID:Addgene_51289 Copy   


  • RRID:Addgene_61336

http://www.addgene.org/61336

Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25386923

Proper citation: RRID:Addgene_61336 Copy   


  • RRID:Addgene_62356

http://www.addgene.org/62356

Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV2a isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with SacII

Proper citation: RRID:Addgene_62356 Copy   


  • RRID:Addgene_62368

http://www.addgene.org/62368

Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV3 isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with EcoRI

Proper citation: RRID:Addgene_62368 Copy   


  • RRID:Addgene_62369

http://www.addgene.org/62369

Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV3 isolate S23
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with EcoRI

Proper citation: RRID:Addgene_62369 Copy   


  • RRID:Addgene_55190

http://www.addgene.org/55190

Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55190 Copy   


  • RRID:Addgene_50559

http://www.addgene.org/50559

Species: Bombyx mori
Genetic Insert: BmAgo3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19460866

Proper citation: RRID:Addgene_50559 Copy   


  • RRID:Addgene_48677

    This resource has 1+ mentions.

http://www.addgene.org/48677

Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24076762

Proper citation: RRID:Addgene_48677 Copy   


  • RRID:Addgene_49018

    This resource has 10+ mentions.

http://www.addgene.org/49018

Species: E. coli
Genetic Insert: Recoded E. coli with all UAG codons and RF1 removed (UAG termination abolished); decreased mutation rate; 37C growth tolerated
Vector Backbone Description: Vector Backbone:E. coli genome; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24136966
Comments: E. coli MG1655 Delta(ybhB-bioAB)::zeoR Delta prfA; all 321 UAG codons changed to UAA This strain is mutS+, which causes a normal spontaneous mutation frequency of ~1E-10. This strain is auxotrophic for d-biotin. The genome sequence of a similar strain (C321.deltaA) was deposited at NCBI (accession # CP006698.1).

Proper citation: RRID:Addgene_49018 Copy   


  • RRID:Addgene_117088

http://www.addgene.org/117088

Species: Arabidopsis thaliana
Genetic Insert: AtPIN1
Vector Backbone Description: Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_117088 Copy   


  • RRID:Addgene_117089

http://www.addgene.org/117089

Species: Arabidopsis thaliana
Genetic Insert: AtPIN2
Vector Backbone Description: Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_117089 Copy   


  • RRID:Addgene_117095

http://www.addgene.org/117095

Species: Other
Genetic Insert: MtPT4-eGFP
Vector Backbone Description: Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_117095 Copy   


  • RRID:Addgene_117096

http://www.addgene.org/117096

Species: Other
Genetic Insert: MtPT4
Vector Backbone Description: Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_117096 Copy   


  • RRID:Addgene_117090

http://www.addgene.org/117090

Species: Arabidopsis thaliana
Genetic Insert: AtNPY1
Vector Backbone Description: Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_117090 Copy   


  • RRID:Addgene_117103

http://www.addgene.org/117103

Species: Arabidopsis thaliana
Genetic Insert: SLAC-deltaCdeltaN
Vector Backbone Description: Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_117103 Copy   


  • RRID:Addgene_117102

http://www.addgene.org/117102

Species: Arabidopsis thaliana
Genetic Insert: SLAC-deltaC
Vector Backbone Description: Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_117102 Copy   


  • RRID:Addgene_117105

http://www.addgene.org/117105

Species: Arabidopsis thaliana
Genetic Insert: SLAH3
Vector Backbone Description: Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_117105 Copy   


  • RRID:Addgene_117100

http://www.addgene.org/117100

Species: Arabidopsis thaliana
Genetic Insert: SLAC1-FL
Vector Backbone Description: Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_117100 Copy   


  • RRID:Addgene_117098

http://www.addgene.org/117098

Species: Arabidopsis thaliana
Genetic Insert: MCA2-eGFP
Vector Backbone Description: Vector Backbone:pPICZc; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_117098 Copy   


http://www.addgene.org/117663

Species: Other
Genetic Insert: pOst1-pro-af(MUT2)-E2-Crimson
Vector Backbone Description: Vector Backbone:pPICZalpha; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:30314480
Comments: Integration plasmid in the pAOX1 locus.

Proper citation: RRID:Addgene_117663 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X