Plasmids   Select Another Resource Report Type

http://www.addgene.org/71265

Species: Other
Genetic Insert: VenusYFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR/Zeo; Vector Types:Gateway Cloning; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:26644504

Proper citation: RRID:Addgene_71265 Copy   

•   Source: Addgene

http://www.addgene.org/73314

Species: Komagataella pastoris
Genetic Insert: Pas2p (peroxisomal membrane targeting region)
Vector Backbone Description: Backbone Size:3329; Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_73314 Copy   

•   Source: Addgene

http://www.addgene.org/73317

Species: Crepis alpina
Genetic Insert: delta-12 fatty acid acetylenase
Vector Backbone Description: Backbone Size:3329; Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_73317 Copy   

•   Source: Addgene

http://www.addgene.org/68306

Genetic Insert: None
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:26350500
Comments: Derived from Lajoie, et. al., Genomically recoded organisms expand biological functions, Science, 2013, with the following genomic modifications: ΔmutS:zeo, ΔtolC, Δbla:tolC, SerB-/ΔSerB

Proper citation: RRID:Addgene_68306 Copy   

•   Source: Addgene

http://www.addgene.org/61336

Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25386923

Proper citation: RRID:Addgene_61336 Copy   

•   Source: Addgene

http://www.addgene.org/50559

Species: Bombyx mori
Genetic Insert: BmAgo3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19460866

Proper citation: RRID:Addgene_50559 Copy   

•   Source: Addgene

http://www.addgene.org/51289

Species: Homo sapiens
Genetic Insert: L1 ORF2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4595; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:21572950
Comments: This plasmid was created using the codon optimized L1RP as a source for the ORF2 coding sequence.

Proper citation: RRID:Addgene_51289 Copy   

•   Source: Addgene

http://www.addgene.org/55190

Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55190 Copy   

•   Source: Addgene

http://www.addgene.org/62356

Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV2a isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with SacII

Proper citation: RRID:Addgene_62356 Copy   

•   Source: Addgene

http://www.addgene.org/62368

Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV3 isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with EcoRI

Proper citation: RRID:Addgene_62368 Copy   

•   Source: Addgene

http://www.addgene.org/62369

Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV3 isolate S23
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with EcoRI

Proper citation: RRID:Addgene_62369 Copy   

•   Source: Addgene

http://www.addgene.org/48733

Species: Discosoma sp
Genetic Insert: dsRed-Express
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:17603495
Comments: This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm

Proper citation: RRID:Addgene_48733 Copy   

•   Source: Addgene

http://www.addgene.org/48734

Species: Discosoma sp
Genetic Insert: dsRed-Express
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19073722
Comments: Note that this plasmid is substantially smaller than the ~8kb native papillomavirus genome. There is a second version of this plasmid with a 2kb stuffer region that is available here: http://www.addgene.org/48733 . Further information can be found here: http://home.ccr.cancer.gov/Lco/target.htm

Proper citation: RRID:Addgene_48734 Copy   

•   Source: Addgene

http://www.addgene.org/48677

Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24076762

Proper citation: RRID:Addgene_48677 Copy   

•   Source: Addgene

http://www.addgene.org/49018

Species: E. coli
Genetic Insert: Recoded E. coli with all UAG codons and RF1 removed (UAG termination abolished); decreased mutation rate; 37C growth tolerated
Vector Backbone Description: Vector Backbone:E. coli genome; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24136966
Comments: E. coli MG1655 Delta(ybhB-bioAB)::zeoR Delta prfA; all 321 UAG codons changed to UAA This strain is mutS+, which causes a normal spontaneous mutation frequency of ~1E-10. This strain is auxotrophic for d-biotin. The genome sequence of a similar strain (C321.deltaA) was deposited at NCBI (accession # CP006698.1).

Proper citation: RRID:Addgene_49018 Copy   

•   Source: Addgene

http://www.addgene.org/87344

Species: Caenorhabditis elegans
Genetic Insert: TRIC-B1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3221; Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:27698420
Comments: Vector pPICZ A and insert sequence were modified as follows: 1. Restriction sites including Pml I; Sfi I; BsmB I; Asp718 I; Kpn I were destroyed during cloning full-length CeTRIC-B1 to the vector. 2. In the C-terminal truncation, the sequence between XhoI and polyhistidine had been deleted. That is to say, restriction sites including Xho I, Sac II, Not I, Apa I, and myc-epitope, were destroyed during truncation. 3. A kozak suqence "ACC" was inserted between the restriction site "EcoR I" and initial codon, we added these 3 bp into insert sequence size. In summary, the size of pPICZ A backbone is changed from 3329 bp to be 3221 bp.

Proper citation: RRID:Addgene_87344 Copy   

•   Source: Addgene

http://www.addgene.org/89910

Species: Homo sapiens
Genetic Insert: HPV16L1+ GFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:many different ones; Vector Types:Unspecified; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:15709003

Proper citation: RRID:Addgene_89910 Copy   

•   Source: Addgene

http://www.addgene.org/78938

Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:27470089

Proper citation: RRID:Addgene_78938 Copy   

•   Source: Addgene

http://www.addgene.org/78934

Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:27470089

Proper citation: RRID:Addgene_78934 Copy   

•   Source: Addgene

http://www.addgene.org/78936

Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:27470089

Proper citation: RRID:Addgene_78936 Copy   

•   Source: Addgene