Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 1 showing 1 ~ 20 out of 12,978 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_53178

    This resource has 1+ mentions.

http://www.addgene.org/53178

Species: Mus musculus
Genetic Insert: CMYC
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24717435
Comments: The mutations found during the QC process have no functional consequence.

Proper citation: RRID:Addgene_53178 Copy   

http://www.addgene.org/248196

Species: Mus musculus
Genetic Insert: The Arl13b noncilium targeting sequence-EGFP-TurboID
Vector Backbone Description: Backbone Size:5382; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38664376

Proper citation: RRID:Addgene_248196 Copy   

http://www.addgene.org/238353

Species: Mus musculus
Genetic Insert: Microexon E35a
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, Other, TOPO TA vector; Bacterial Resistance:Ampicillin
Comments: Microexon E35a sequence: gagacagagtcagatcaagatgatgag

Proper citation: RRID:Addgene_238353 Copy   

http://www.addgene.org/225345

Species: Mus musculus
Genetic Insert: Gad1
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_225345 Copy   

http://www.addgene.org/225346

Species: Mus musculus
Genetic Insert: Slc17A7
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_225346 Copy   

http://www.addgene.org/223310

Species: Mus musculus
Genetic Insert: shErbb4
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39405910

Proper citation: RRID:Addgene_223310 Copy   

http://www.addgene.org/223307

Species: Mus musculus
Genetic Insert: Nlgn1 without PBM - CTEV
Vector Backbone Description: Vector Backbone:pTag4C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39405910

Proper citation: RRID:Addgene_223307 Copy   

    • RRID:Addgene_223305

http://www.addgene.org/223305

Species: Mus musculus
Genetic Insert: Nlgn1
Vector Backbone Description: Vector Backbone:pTag4C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39405910

Proper citation: RRID:Addgene_223305 Copy   

http://www.addgene.org/223309

Species: Mus musculus
Genetic Insert: shErbb4
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39405910

Proper citation: RRID:Addgene_223309 Copy   

http://www.addgene.org/182908

Species: Mus musculus
Genetic Insert: anti-S100B (human) heavy chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_182908 Copy   

http://www.addgene.org/182905

Species: Mus musculus
Genetic Insert: anti-S100B (human) light chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_182905 Copy   

http://www.addgene.org/182904

Species: Mus musculus
Genetic Insert: anti-S100B (human) heavy chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_182904 Copy   

http://www.addgene.org/182912

Species: Mus musculus
Genetic Insert: anti-S100B (human) heavy chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_182912 Copy   

http://www.addgene.org/182913

Species: Mus musculus
Genetic Insert: anti-S100B (human) light chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_182913 Copy   

    • RRID:Addgene_191945

http://www.addgene.org/191945

Species: Mus musculus
Genetic Insert: Opa1-K301A
Vector Backbone Description: Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_191945 Copy   

http://www.addgene.org/206865

Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5086; Vector Backbone:pBabePuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36069770

Proper citation: RRID:Addgene_206865 Copy   

http://www.addgene.org/253954

Species: Mus musculus
Genetic Insert: Pdzd8
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40246839

Proper citation: RRID:Addgene_253954 Copy   

http://www.addgene.org/61572

Species: Mus musculus
Genetic Insert: Pvalb-2A-Flpo
Vector Backbone Description: Backbone Size:2682; Vector Backbone:pUC57; Vector Types:Recombinase-mediated cassette exchange using Flp recombinase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25741722

Proper citation: RRID:Addgene_61572 Copy   

    • RRID:Addgene_168479

http://www.addgene.org/168479

Species: Mus musculus
Genetic Insert: CD47
Vector Backbone Description: Backbone Marker:Jeng-Shin Lee, Harvard University; Backbone Size:6079; Vector Backbone:AAV-MCS8; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34197341

Proper citation: RRID:Addgene_168479 Copy   

http://www.addgene.org/167574

Species: Mus musculus
Genetic Insert: Ribo-GCaMP8m
Vector Backbone Description: Backbone Size:2868; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36739289

Proper citation: RRID:Addgene_167574 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch