Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: VenusYFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR/Zeo; Vector Types:Gateway Cloning; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:26644504
Proper citation: RRID:Addgene_71265 Copy
Species: Komagataella pastoris
Genetic Insert: Pas2p (peroxisomal membrane targeting region)
Vector Backbone Description: Backbone Size:3329; Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Proper citation: RRID:Addgene_73314 Copy
Species: Crepis alpina
Genetic Insert: delta-12 fatty acid acetylenase
Vector Backbone Description: Backbone Size:3329; Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Proper citation: RRID:Addgene_73317 Copy
Genetic Insert: None
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:26350500
Comments: Derived from Lajoie, et. al., Genomically recoded organisms expand biological functions, Science, 2013, with the following genomic modifications: ΔmutS:zeo, ΔtolC, Δbla:tolC, SerB-/ΔSerB
Proper citation: RRID:Addgene_68306 Copy
Species: Discosoma sp
Genetic Insert: dsRed-Express
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:17603495
Comments: This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm
Proper citation: RRID:Addgene_48733 Copy
Species: Discosoma sp
Genetic Insert: dsRed-Express
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19073722
Comments: Note that this plasmid is substantially smaller than the ~8kb native papillomavirus genome. There is a second version of this plasmid with a 2kb stuffer region that is available here: http://www.addgene.org/48733 . Further information can be found here: http://home.ccr.cancer.gov/Lco/target.htm
Proper citation: RRID:Addgene_48734 Copy
Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48677 Copy
Species: E. coli
Genetic Insert: Recoded E. coli with all UAG codons and RF1 removed (UAG termination abolished); decreased mutation rate; 37C growth tolerated
Vector Backbone Description: Vector Backbone:E. coli genome; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24136966
Comments: E. coli MG1655 Delta(ybhB-bioAB)::zeoR Delta prfA; all 321 UAG codons changed to UAA
This strain is mutS+, which causes a normal spontaneous mutation frequency of ~1E-10. This strain is auxotrophic for d-biotin.
The genome sequence of a similar strain (C321.deltaA) was deposited at NCBI (accession # CP006698.1).
Proper citation: RRID:Addgene_49018 Copy
Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV2a isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with SacII
Proper citation: RRID:Addgene_62356 Copy
Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV3 isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with EcoRI
Proper citation: RRID:Addgene_62368 Copy
Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV3 isolate S23
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with EcoRI
Proper citation: RRID:Addgene_62369 Copy
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29986052
Comments: See Supplemental Documents for strain verification protocols and data.
Proper citation: RRID:Addgene_114269 Copy
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29986052
Comments: See Supplemental Documents for strain verification protocols and data.
Proper citation: RRID:Addgene_114268 Copy
Species: Homo sapiens
Genetic Insert: PLD4
Vector Backbone Description: Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:34620855
Proper citation: RRID:Addgene_173852 Copy
Species: Homo sapiens
Genetic Insert: PLD3
Vector Backbone Description: Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:34620855
Proper citation: RRID:Addgene_173851 Copy
Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5728; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17449 Copy
Species: Homo sapiens
Genetic Insert: ACE2
Vector Backbone Description: Vector Backbone:pFUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33093202
Comments: Please visit https://doi.org/10.1101/2020.07.31.231746 for bioRxiv preprint.
Proper citation: RRID:Addgene_159762 Copy
Species: wheat
Genetic Insert: wheat GRF4-GIF1 chimera
Vector Backbone Description: Backbone Size:2076; Vector Backbone:pDONR-zeo; Vector Types:Entry clon; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33046875
Proper citation: RRID:Addgene_160392 Copy
Species: Vitis
Genetic Insert: Vitis miR396-resistant GRF4-GIF1 chimera
Vector Backbone Description: Backbone Size:2076; Vector Backbone:pDONR-zeo; Vector Types:Entry clon; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33046875
Proper citation: RRID:Addgene_160395 Copy
Species: Maristella sp. SVU
Genetic Insert: luciferase
Vector Backbone Description: Backbone Marker:Thermo Fisher; Backbone Size:3600; Vector Backbone:pPICZ-alphaC; Vector Types:Yeast Expression, Luciferase; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33031624
Comments: Please note: Plasmid contains a 39bp deletion that removes the N-terminal amino acids AQDCYEFTLEKRE from the luciferase compared to the depositor's insert sequence. It is not known how this discrepancy affects the plasmid function, though the plasmid was functional in the depositor's experiments.
Proper citation: RRID:Addgene_160426 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.