Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,343 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGEM-7Zf-deleted
 
Resource Report
Resource Website 		RRID:Addgene_23161 Ribonuclease assay sub2 Ampicillin PMID:17889667 Backbone Size:2997; Vector Backbone:pGEM-7Zf(+); Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin 2026-07-25 12:44:39 0
pIRESpuro-Flag-Pol b(K72A)
 
Resource Report
Resource Website 		RRID:Addgene_23258 DNA polymerase beta (K72A) Homo sapiens Ampicillin PMID:20068071 Backbone Marker:Clontech, modifed by Sobol Lab; Backbone Size:7100; Vector Backbone:pIRESpuroGWB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin K72A 2026-07-25 12:44:39 0
pIRESneo-MPG(N169D)
 
Resource Report
Resource Website 		RRID:Addgene_23259 N-methylpurine DNA glycosylase (N169D) Homo sapiens Ampicillin PMID:20068071 Backbone Marker:Clontech; Backbone Size:5300; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin N169D 2026-07-25 12:44:39 0
GFP-RelA
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_23255 p65 Homo sapiens Kanamycin PMID:11533489 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:44:39 30
pHR'CMVGFP_hRIF1(406-2446)IREShygro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23135 RIF1 deletion construct Homo sapiens Ampicillin PMID:15583028 Backbone vector sequence is only approximated. Please contact the Trono lab for full vector sequence. Backbone Marker:Didier Trono Lab; Backbone Size:10000; Vector Backbone:pHR'CMVGFPIREShygro_WSIN18; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:44:38 4
pSIF-H1-hpolb-copGFP
 
Resource Report
Resource Website 		RRID:Addgene_23256 DNA polymerase beta shRNA Homo sapiens Ampicillin PMID:20068071 shRNA oligo sequence is - 5’-ctggcagacgcaacctaatgggacttcctgtcagatcctattgggttgtgtctgccagttttt Backbone Marker:SIB; Backbone Size:6400; Vector Backbone:pSIF-H1-copGFP; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-07-25 12:44:39 0
pBM3
 
Resource Report
Resource Website 		RRID:Addgene_23096 yeast Histone H3-2 and Histone H4-2 Saccharomyces cerevisiae Ampicillin PMID:12039950 HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701 Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Histone H3 changed Serine 10 to Aspartate and Lysine 14 to Glutamine, H3 S10D, K14Q. 2026-07-25 12:44:38 0
pBM4
 
Resource Report
Resource Website 		RRID:Addgene_23097 yeast Histone H3-2 and Histone H4-2 Saccharomyces cerevisiae Ampicillin PMID:12039950 HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701 Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Histone 3 changed Serine 10 to Aspartate and Lysine 14 to Arginine, H3 S10D, K14R. 2026-07-25 12:44:38 0
pCMV-sport2-mGCN5 FU, FLAG Tagged
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23098 mouse Gcn5 mRNA Mus musculus Ampicillin PMID:10675335 Backbone Marker:Invitrogen; Backbone Size:4473; Vector Backbone:pCMV-sport2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin missing 50 bp upstream of ATG start site. 2026-07-25 12:44:38 5
pcDNA3.1-p300
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_23252 p300 Homo sapiens Ampicillin PMID:12456660 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:39 44
pCMV-Tag2B Flag BimEL(TD)
 
Resource Report
Resource Website 		RRID:Addgene_23092 Bim EL (TD) Mus musculus Kanamycin PMID:18498746 Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Changed Threonine 112 to Aspartate 2026-07-25 12:44:38 0
pCMV-Tag2B Flag BimEL(TA)
 
Resource Report
Resource Website 		RRID:Addgene_23093 Bim EL (TA) Mus musculus Kanamycin PMID:18498746 Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Changed Threonine 112 to Alanine 2026-07-25 12:44:38 0
Tpa1(21-644)
 
Resource Report
Resource Website 		RRID:Addgene_23140 Tpa1 Saccharomyces cerevisiae Ampicillin PMID:20040577 This construct has a mutation causing N565D in the aa sequence. The depositor does know the effect of this mutation. However, it is not part of the active site. Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-20 2026-07-25 12:44:38 0
B23(9-122)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23142 B23 core Homo sapiens Ampicillin PMID:17879352 Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-8 2026-07-25 12:44:39 1
pWZ414-F22
 
Resource Report
Resource Website 		RRID:Addgene_23080 yeast Histone H3-2 and Histone H4-2 Saccharomyces cerevisiae Ampicillin PMID:12620224 HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701 Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Histone H4 changed Lysine 5 to Arginine, H4 K5R. 2026-07-25 12:44:38 0
pFastBac1-Flag-Timeless
 
Resource Report
Resource Website 		RRID:Addgene_23119 Timeless Homo sapiens Ampicillin PMID:20233725 Backbone Marker:Invitrogen; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:38 0
pcDNA3-Flag-Tipin-E190A
 
Resource Report
Resource Website 		RRID:Addgene_23115 Tipin Homo sapiens Ampicillin PMID:20233725 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin changed Glutamate 190 to Alanine 2026-07-25 12:44:38 0
pWZ414-F55
 
Resource Report
Resource Website 		RRID:Addgene_23079 yeast Histone H3-2 and Histone H4-2 Saccharomyces cerevisiae Ampicillin PMID:9606197 HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701 Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Histone H3 changed Lysine 9 to Arginine, H3 K9R Histone H4 changed Lysines 5 and 12 to Arginines, H4 K5,12R 2026-07-25 12:44:38 0
pcDNA3-Flag-Tipin-E185A
 
Resource Report
Resource Website 		RRID:Addgene_23114 Tipin Homo sapiens Ampicillin PMID:20233725 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin changed Glutamate 185 to Alanine 2026-07-25 12:44:38 0
pWZ414-F51
 
Resource Report
Resource Website 		RRID:Addgene_23075 yeast Histone H3-2 and Histone H4-2 Saccharomyces cerevisiae Ampicillin PMID:9606197 HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701 Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Histone H4 changed Lysines 5 and 12 to Glutamine, H4 K5,12Q 2026-07-25 12:44:38 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch