Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 96 showing 1901 ~ 1920 out of 739,423 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_23161

http://www.addgene.org/23161

Species:
Genetic Insert: Ribonuclease assay sub2
Vector Backbone Description: Backbone Size:2997; Vector Backbone:pGEM-7Zf(+); Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_23161 Copy   

http://www.addgene.org/23258

Species: Homo sapiens
Genetic Insert: DNA polymerase beta (K72A)
Vector Backbone Description: Backbone Marker:Clontech, modifed by Sobol Lab; Backbone Size:7100; Vector Backbone:pIRESpuroGWB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_23258 Copy   

    • RRID:Addgene_23259

http://www.addgene.org/23259

Species: Homo sapiens
Genetic Insert: N-methylpurine DNA glycosylase (N169D)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5300; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_23259 Copy   

    • RRID:Addgene_23255

    This resource has 10+ mentions.

http://www.addgene.org/23255

Species: Homo sapiens
Genetic Insert: p65
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_23255 Copy   

http://www.addgene.org/23135

Species: Homo sapiens
Genetic Insert: RIF1 deletion construct
Vector Backbone Description: Backbone Marker:Didier Trono Lab; Backbone Size:10000; Vector Backbone:pHR'CMVGFPIREShygro_WSIN18; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Backbone vector sequence is only approximated. Please contact the Trono lab for full vector sequence.

Proper citation: RRID:Addgene_23135 Copy   

    • RRID:Addgene_23256

http://www.addgene.org/23256

Species: Homo sapiens
Genetic Insert: DNA polymerase beta shRNA
Vector Backbone Description: Backbone Marker:SIB; Backbone Size:6400; Vector Backbone:pSIF-H1-copGFP; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: shRNA oligo sequence is - 5’-ctggcagacgcaacctaatgggacttcctgtcagatcctattgggttgtgtctgccagttttt

Proper citation: RRID:Addgene_23256 Copy   

    • RRID:Addgene_23096

http://www.addgene.org/23096

Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments: HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701

Proper citation: RRID:Addgene_23096 Copy   

    • RRID:Addgene_23097

http://www.addgene.org/23097

Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments: HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701

Proper citation: RRID:Addgene_23097 Copy   

http://www.addgene.org/23098

Species: Mus musculus
Genetic Insert: mouse Gcn5 mRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4473; Vector Backbone:pCMV-sport2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_23098 Copy   

    • RRID:Addgene_23252

    This resource has 10+ mentions.

http://www.addgene.org/23252

Species: Homo sapiens
Genetic Insert: p300
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_23252 Copy   

http://www.addgene.org/23092

Species: Mus musculus
Genetic Insert: Bim EL (TD)
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_23092 Copy   

http://www.addgene.org/23093

Species: Mus musculus
Genetic Insert: Bim EL (TA)
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_23093 Copy   

    • RRID:Addgene_23140

http://www.addgene.org/23140

Species: Saccharomyces cerevisiae
Genetic Insert: Tpa1
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: This construct has a mutation causing N565D in the aa sequence. The depositor does know the effect of this mutation. However, it is not part of the active site.

Proper citation: RRID:Addgene_23140 Copy   

    • RRID:Addgene_23142

    This resource has 1+ mentions.

http://www.addgene.org/23142

Species: Homo sapiens
Genetic Insert: B23 core
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_23142 Copy   

    • RRID:Addgene_23080

http://www.addgene.org/23080

Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments: HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701

Proper citation: RRID:Addgene_23080 Copy   

http://www.addgene.org/23119

Species: Homo sapiens
Genetic Insert: Timeless
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_23119 Copy   

http://www.addgene.org/23115

Species: Homo sapiens
Genetic Insert: Tipin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_23115 Copy   

    • RRID:Addgene_23079

http://www.addgene.org/23079

Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments: HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701

Proper citation: RRID:Addgene_23079 Copy   

http://www.addgene.org/23114

Species: Homo sapiens
Genetic Insert: Tipin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_23114 Copy   

    • RRID:Addgene_23075

http://www.addgene.org/23075

Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments: HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701

Proper citation: RRID:Addgene_23075 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch