Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

744,367 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
DsRed-Nix
 
Resource Report
Resource Website 		RRID:Addgene_100763 BCL2 interacting protein 3 like Homo sapiens Ampicillin Backbone Size:6078; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 01:56:10 0
HA-CPI-17-T38A-NES
 
Resource Report
Resource Website 		RRID:Addgene_100779 CPI-17-T38A-NES Homo sapiens Ampicillin Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin T38A Addgene 2026-10-31 01:56:10 0
pXJ42-p110 CUX1
 
Resource Report
Resource Website 		RRID:Addgene_100814 p110 CUX1 (amino acids 878-1505) Homo sapiens Ampicillin PMID:18347061 Vector Backbone:pXJ42; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Contains amino acids 878-1505 Addgene 2026-10-31 01:56:10 0
pTRIPZ shCUX1-5328
 
Resource Report
Resource Website 		RRID:Addgene_100815 TGCTGTTGACAGTGAGCGTCTTCTCGTTTGAAACTTTGAATAGTGAAGCCA Ampicillin PMID:24618719 Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-31 01:56:10 0
pLKO-sh-Nix
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100770 Lenti-sh-Nix Homo sapiens Ampicillin PMID:33044904 Backbone Marker:Addgene; Backbone Size:7032; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-31 01:56:10 2
HA-CPI-17-wt-NLS
 
Resource Report
Resource Website 		RRID:Addgene_100776 CPI-17-NLS Homo sapiens Ampicillin Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 01:56:10 0
HA-CPI-17-T38E-NLS
 
Resource Report
Resource Website 		RRID:Addgene_100778 CPI-17-T38E-NLS Homo sapiens Ampicillin Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin T38E Addgene 2026-10-31 01:56:10 0
pCAG-N2cG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100811 rabies virus CVS N2c strain glycoprotein gene rabies virus Ampicillin Backbone Marker:Connie Cepko; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 01:56:10 3
pLKO-sh-BNIP3-FL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100771 Lenti-sh-BNIP3-FL Homo sapiens Ampicillin Backbone Marker:Addgene; Backbone Size:7032; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-31 01:56:10 1
HA-CPI-17-wt
 
Resource Report
Resource Website 		RRID:Addgene_100772 CPI-17 Homo sapiens Ampicillin Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 01:56:10 0
MBP-CHC(1-1074)-His6
 
Resource Report
Resource Website 		RRID:Addgene_100748 CLTC Homo sapiens Ampicillin PMID:28954824 Vector Backbone:pMALPre-His; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Residues 1-1074 Addgene 2026-10-31 01:56:10 0
CD8-pTagRFP657-LOVpep (T406A, T407A, I532A)
 
Resource Report
Resource Website 		RRID:Addgene_100742 CD8A Homo sapiens Kanamycin PMID:28954824 Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Truncated Addgene 2026-10-31 01:56:10 0
GST-beta2(616-951)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100743 AP2B1 Homo sapiens Ampicillin PMID:28954824 Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Long isoform Addgene 2026-10-31 01:56:10 1
GST-beta2(616-951)∆CBM
 
Resource Report
Resource Website 		RRID:Addgene_100745 beta2 adaptin Homo sapiens Ampicillin PMID:28954824 Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Long isoform with deletion of clathrin binding motif Addgene 2026-10-31 01:56:10 0
SH4-FRB-mRFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100741 Fyn Kanamycin PMID:28954824 Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin SH4 domain only Addgene 2026-10-31 01:56:10 1
Myc-Nix-MaoB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100757 Nix-MaoB Homo sapiens Ampicillin PMID:29511336 Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin TM domain replaced by MaoB Addgene 2026-10-31 01:56:10 1
pGEX4T-1-Nix
 
Resource Report
Resource Website 		RRID:Addgene_100759 GST-Nix Homo sapiens Ampicillin Use E. coli LB21 for expression Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4900; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 01:56:10 0
Myc-Nix-delta TM
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100755 Nix-_TM Homo sapiens Ampicillin PMID:29511336 Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin TM deletion Addgene 2026-10-31 01:56:10 1
Myc-Nix-CytoB5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100756 Nix-CytoB5 Homo sapiens Ampicillin PMID:29511336 Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin TM domain replaced by CytoB Addgene 2026-10-31 01:56:10 1
FTL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100750 FTL Homo sapiens Kanamycin PMID:29973588 Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-31 01:56:10 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch