Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Mus musculus GABA transporter 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: To generate the fluorescent mutants mGAT10XFP and mGAT1XFP* through mGAT1XFP45, the wild-type mGAT1 open reading frame (ORF) was subcloned without its original stop codon into the HindIII and EcoRI sites of the pcDNA3.1(+) expression vector multiple cloning site (MCS). XFP ORFs were then subcloned downstream from and in frame with the mGAT1 ORF at the NotI and XbaI sites of the pcDNA3.1(+) MCS. This resulted in a 12–amino acid spacer between the end of the mGAT1 sequence and the beginning of the fluorophore. The depositors modified a method for the integration of PCR fragments without the use of restriction enzymes (Geiser et al., 2001) to add the final 3, 8, 20, 28, or 45 codons of the human GAT1 (hGAT1) ORF. These were amplified from a source plasmid using the proof-reading PfuTurbo Cx Hotstart polymerase with 5′ and 3′ extensions corresponding to the 20–22-nt regions that flanked the intended site of insertion, such that the PCR product integrated in-frame immediately after the fluorophore sequence when used as the primers in a subsequent QuikChange II XL mutagenesis PCR reaction. For mGAT1XFP*, the depositors simply added a GTC codon for Val after the fluorophore ORF.
The attached image displays the protein sequences of the modified regions of mGAT1 for each fluorescent construct. mGAT10CFP and mGAT10YFP repeated the fusion design of mGAT10GFP but with the fluorophore exchanged as annotated. The three C-terminal residues of the mGAT0XFP fusions are -YKI-CO2−, which comprises a broadly defined consensus PDZ class II–interacting motif (X-φ-X-φ, where φ designates a hydrophobic residue and X any residue) (Sheng and Sala, 2001; Hung and Sheng, 2002). The depositors searched the Ensembl databases using Biomart (http://www.ebi.ac.uk/biomart) (Spudich et al., 2007) and applied the GO:0005886 “plasma membrane” cellular component filter. The search identified no known membrane proteins possessing the -YKI-CO2− C-terminal sequence.
In the mGAT1XFP* constructs, the depositors defined the terminal residue P(0) more narrowly, changing the terminal isoleucine residue present in mGAT10XFP to a valine in mGAT1XFP*. The resulting C-terminal sequence, -YKV-CO2−, reconstituted a functional PDZ class II–interacting motif present in Ephrin B receptors, a class that relies on interactions with the PDZ domain–containing proteins for clustering (Torres et al., 1998; Brückner et al., 1999; Lin et al., 1999; Madsen et al., 2005).
Other constructs in the C-terminal XFP fusion series, mGAT1XFP3, mGAT1XFP8, mGAT1XFP20, mGAT1XFP28, and mGAT1XFP45, had the most C-terminal 3, 8, 20, 28, or 45 residues of the hGAT1 appended after the mGAT1XFP fusion. The differences in nucleotide sequence between the hGAT1 and mGAT1 C termini were a useful source of positive identification when the depositors analyzed the clones during construction.
PCR integration was applied to amplify and insert EYFP or ECFP directly between residues R565 and L566, I570 and Q571, or V577 and R578 of mGAT1 to generate the mGAT15xxXFP5xxCT constructs. The site of XFP insertion in GAT1 is highlighted in the nomenclatures for these constructs by residue numbers flanking the fluorophore, and the “CT” denotes that the insertion occurs within the C terminus.
Please see the associated article for more detailed information regarding construct creation and usage.
Proper citation: RRID:Addgene_41667 Copy
Species:
Genetic Insert: E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] dnaG.Q576A
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41700 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:3580; Vector Backbone:pUG66; Vector Types:Yeast Expression, PCR template; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41828 Copy
Species:
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: For additional information:
http://arep.med.harvard.edu/human_crispr/
Proper citation: RRID:Addgene_41815 Copy
Species: Homo sapiens
Genetic Insert: SOX2, KLF4
Vector Backbone Description: Backbone Size:9364; Vector Backbone:pCE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41814 Copy
Species: Homo sapiens
Genetic Insert: H9 Super-2
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMalLP; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: This is an e. coli periplasmic expression vector.
H9 has the following mutations compared to wildtype IL-2: L80F, R81F, L85V, I86V, I92F
Proper citation: RRID:Addgene_41811 Copy
Species: Homo sapiens
Genetic Insert: IL2
Vector Backbone Description: Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41807 Copy
Species: Homo sapiens
Genetic Insert: IL2
Vector Backbone Description: Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41806 Copy
Species: Drosophila melanogaster
Genetic Insert: kinesin heavy chain
Vector Backbone Description: Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41758 Copy
Species: Drosophila melanogaster
Genetic Insert: kinesin heavy chain
Vector Backbone Description: Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41755 Copy
Species: Drosophila melanogaster
Genetic Insert: kinesin heavy chain
Vector Backbone Description: Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41753 Copy
Species: Homo sapiens
Genetic Insert: Halotag 2
Vector Backbone Description: Backbone Marker:INVITROGEN; Backbone Size:5000; Vector Backbone:PCDNA5; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Alternate plasmid name: pCDNA5-KGH2
Proper citation: RRID:Addgene_41742 Copy
Species: Mus musculus
Genetic Insert: Klf5
Vector Backbone Description: Backbone Marker:Oligoengine; Vector Backbone:pSuper-Retro; Vector Types:RNAi; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41740 Copy
Species:
Genetic Insert: E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] xonA-, recJ-,xseA-, exoX- and redα- dnaG.Q576A tolC-
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41699 Copy
Species: Mus musculus
Genetic Insert: Notch-1 Lin-Notch-glp (LNG) repeat-containing construct, CC->SS
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Alternate plasmid name: pCS2 NLNR CC>SS-6MT
All Notch1 constructs deposited here were cloned into the pCS2+MT vector (Rupp et al., 1994; Turner and Weintraub, 1994) and have the C-terminal 348 residues (aa 2185 to C terminus) of Notch replaced with a hexameric myc tag to facilitate biochemical analysis. PCR mutagenesis was used to create the C1675S and C1682S mutations in LNR (Addgene plasmid #41738).
Proper citation: RRID:Addgene_41739 Copy
Species: Mus musculus
Genetic Insert: Notch-1 Intracellular Domain
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Alternate plasmid name: pCS2 NICv1744-6MT
To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737).
Proper citation: RRID:Addgene_41730 Copy
Species: Homo sapiens
Genetic Insert: DNAJA4 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6200; Vector Backbone:psiCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Full-length 3′UTR of DNAJA4 was cloned downstream of a renilla luciferase reporter into the psiCheck2 dual luciferase reporter vector
Proper citation: RRID:Addgene_41847 Copy
Species: Homo sapiens
Genetic Insert: BRCA1
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: The BRCA1 insert in this plasmid contains the following common polymorphisms when compared to GenBank reference sequence NP_009225.1: P871L, E1038G, K1182R, and S1613G. These SNPs were likely present in the original cDNA isolate.
Proper citation: RRID:Addgene_41968 Copy
Species: Homo sapiens
Genetic Insert: ApoE 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Full-length 3′UTR of ApoE was cloned downstream of renilla luciferase reporter in the psiCheck2 dual luciferase reporter vector
Proper citation: RRID:Addgene_41846 Copy
Species: Synthetic
Genetic Insert: 4-4-20
Vector Backbone Description: Backbone Size:6142; Vector Backbone:pCT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_41845 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.