Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: A. victoria
Genetic Insert: CyPet
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCyPet-C1-Control; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22779 Copy
Species: Mus musculus
Genetic Insert: mSin3B
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5565; Vector Backbone:pACT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Used to see if truncated form of mSin3b would be biologically active when binding Mouse Myt1
This short form of mSIN3B was PCR'd from the full-length clone (pcDNAAmSin3B-Flag) which was a gift of Dr. Ronald dePinho.
Proper citation: RRID:Addgene_22653 Copy
Species:
Genetic Insert: fret-STOP-fret
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Plasmid containing FRT-STOP-FRT cassette for use in expressing genes only after Flp-mediated recombination.
It's like the LSL cassette ( http://www.addgene.org/11584 but this one is a FSF cassette
Proper citation: RRID:Addgene_22774 Copy
Species:
Genetic Insert: OVA-SIY
Vector Backbone Description: Backbone Marker:Available at Addgene (#20905); Backbone Size:0; Vector Backbone:Luc.Cre (aka: UbC.Luciferase.PGK.Cre); Vector Types:Mammalian Expression, Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22777 Copy
Species: Homo sapiens
Genetic Insert: estrogen receptor beta
Vector Backbone Description: Backbone Size:7136; Vector Backbone:pCDNA3.1/nv5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22770 Copy
Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Marker:R. Armstrong; Backbone Size:5635; Vector Backbone:pIRESRed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Mu Myt1 complete sequence includes 7 Zn Fingers and a Myc Tag. This was subcloned into pIRES/Red made by R. A. Armstrong. The DsRed does not express due to problem with IRES
This Myt1-7zf DNA was cut from the full-length clone (pMycMyt1-7zf) which was a gift of Dr. Jacob Hecksher-Sorensen.
Proper citation: RRID:Addgene_22652 Copy
Species: Homo sapiens
Genetic Insert: Rev Erb alpha
Vector Backbone Description: Backbone Marker:Available at Addgene (#16405); Backbone Size:9000; Vector Backbone:pAdTrack-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22745 Copy
Species: Mus musculus
Genetic Insert: shRev-Erbalpha
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: targeting sequence: GCGCTTTGCATCGTTGTTCAA
Proper citation: RRID:Addgene_22747 Copy
Species: Mus musculus
Genetic Insert: shALAS-1
Vector Backbone Description: Backbone Marker:Available at Addgene (#16404); Backbone Size:8300; Vector Backbone:pAdTrack; Vector Types:Mammalian Expression, Adenoviral, RNAi; Bacterial Resistance:Kanamycin
References:
Comments: targeting sequence: CCAAGATAGTAGCATTTGAAA
Proper citation: RRID:Addgene_22748 Copy
Species:
Genetic Insert: microRNA 9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5699; Vector Backbone:pcDNA-6.2 GW/EmGFP miR-neg control; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin
References:
Comments:
Proper citation: RRID:Addgene_22741 Copy
Species:
Genetic Insert: modified pCMV-DsRed-Express (Clontech)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4600; Vector Backbone:pCMV-DsRed-Express; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: modified pCMV-DsRed-Express (Clontech)) Have inserted 2 sites (NheI and BamHI upstream of DsRed-Express cassette and 2 sites downstream (BglII and NheI) = NheI-BamHI-DsRed-Express-BglII-EcoRI
Proper citation: RRID:Addgene_22743 Copy
Species:
Genetic Insert: CXCR4 control sponge
Vector Backbone Description: Backbone Marker:Weinberg lab (Addgene#:1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: Subclond from CMV-CXCR4 control sponge, as described in Ebert et al. (Nature Methods, 2007)
Sequence of sponge: AAGUUUUCAGAAAGCUAACA
Proper citation: RRID:Addgene_22744 Copy
Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pCR-Blunt II TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin
References:
Comments: 580bp Myt1 insert can be released with EcoRI. This is the 580bp cDNA probe for Northern blots. Paper is in preparation. Tentatively titled "The Myelin Transcription Factor 1 (Myt1) is Essential for Neural Development"
Proper citation: RRID:Addgene_22740 Copy
Species: Mus musculus
Genetic Insert: PPARalpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4000; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The PPARa cDNA was isolated from an adipocyte lambda ZAPII cDNA library (Tontonoz et al 1994 Genes Dev 8:1224-1234).
Proper citation: RRID:Addgene_22751 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: additional article reference: Shinmura, K. et al. Direct evidence for the role of centrosomally localized p53 in the regulation of centrosome duplication. Oncogene. 2007 May 3;26(20):2939-44. Epub 2006 Oct 30.
Proper citation: RRID:Addgene_22727 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: additional article reference: Bowman, T. et al. Tissue-specific inactivation of p53 tumor suppression in the mouse. Genes Dev. 1996 Apr 1;10(7):826-35.
Proper citation: RRID:Addgene_22729 Copy
Species: mushroom
Genetic Insert: a variant of Discosoma sp. red fluorescent protein
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo; Backbone Size:4800; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22724 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22725 Copy
Species: Homo sapiens
Genetic Insert: E1A-like inhibitor of differentiation 1
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4938; Vector Backbone:pGex2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22689 Copy
Species:
Genetic Insert: Lox71-FRT-PGK-hygro-FRT-Lox2272
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3060; Vector Backbone:pBluescript KS+; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Please note that the plasmid names and lox sites have been corrected since publication.
Proper citation: RRID:Addgene_22731 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
