Plasmids   Select Another Resource Report Type

http://www.addgene.org/102801

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE Precursor strain = RF4 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu Please note- RF17 strain has knockouts in aspC, tyrB, and ilvE genes and requires the presence of L-Asp, L-Tyr, L-Phe, L-Ile plus L-Leu for (slow) growth in M63 minimal medium. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378.

Proper citation: RRID:Addgene_102801 Copy   

•   Source: Addgene

http://www.addgene.org/61440

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4600000; Vector Backbone:E. coli K-12 MG1655 genome; Vector Types:; Bacterial Resistance:None
References:
Comments: This strain carries the DE3 lysogen.

Proper citation: RRID:Addgene_61440 Copy   

•   Source: Addgene

http://www.addgene.org/61911

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = tyrA Precursor strain = C43(DE3) modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Tyr) Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61911 Copy   

•   Source: Addgene

http://www.addgene.org/61912

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = glnA Precursor strain = C43(DE3) modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = Gln Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61912 Copy   

•   Source: Addgene

http://www.addgene.org/61919

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = cyo ilvE avtA aspC hisG metA Precursor strain = ML23 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Met *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61919 Copy   

•   Source: Addgene

http://www.addgene.org/61915

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = cyo ilvE avtA aspC hisG asnA Precursor strain = ML23 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61915 Copy   

•   Source: Addgene

http://www.addgene.org/61916

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = cyo ilvE avtA aspC hisG asnA asnB Precursor strain = ML24 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Asn *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61916 Copy   

•   Source: Addgene

http://www.addgene.org/61921

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = cyo ilvE avtA aspC hisG argH metA lysA thrC asnB Precursor strain = ML41 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg, Met, Lys, Thr *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61921 Copy   

•   Source: Addgene

http://www.addgene.org/61961

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = metA Precursor strain = C43(DE3) Selective amino acid labeling (and/or requirement) = Met Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_61961 Copy   

•   Source: Addgene

http://www.addgene.org/62070

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = thrC Precursor strain = BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Thr Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62070 Copy   

•   Source: Addgene

http://www.addgene.org/62077

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = trpA trpB Precursor strain = BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Trp## ##RF12 strain requires Trp for growth in M63 minimal medium. For effective Trp labeling of a recombinant protein, the presence of 0.4-1 mM Tyr in growth medium to repress the tyrB gene is recommended. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62077 Copy   

•   Source: Addgene

http://www.addgene.org/62073

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = aspC tyrB hisG Precursor strain = RF4 modified from the parent Escherichia coli BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Asp++++, Tyr, (Phe), His ++++RF4, RF5, and RF13 strains have knockouts in both aspC and tyrB genes and therefore require the presence of L-Asp (but not L-Glu) for growth in M63 minimal medium. These strains can be used for selective labeling of selected aromatic amino acid(s) such as Tyr (RF4, RF5, RF13) and/or Trp (RF13). We have NOT tested if these strains could also be used for selective Asp labeling studies (under investigation). Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62073 Copy   

•   Source: Addgene

http://www.addgene.org/62076

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = lysA Precursor strain = BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Lys Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62076 Copy   

•   Source: Addgene

http://www.addgene.org/62819

Species:
Genetic Insert: see comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: MG1655 + lacIq intergrated at intS + Pcon::TetR inserted into the chromosome at galK + ΔglgCAP + ΔcsrB + ΔcsrC + ΔcsrD

Proper citation: RRID:Addgene_62819 Copy   

•   Source: Addgene

http://www.addgene.org/196340

Species: n/a
Genetic Insert: ΔcyaA ΔcpdA ΔlacY
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Primers: oSK285, cpdA-fwd: GAGTGGGCATAAATGAAGCG oSK286, cpdA-rev: CACTGCGGGCAGCATAAA oSK287, lacY-fwd: CCGGTCGCTACCATTACCAG oSK288, lacY-rev: CTTTCGGTCATTGGCATGTTC oSK289, CyaA-fwd: GCGCATCTTTCTTTACGGTC oSK290, CyaA-rev: GCTGCACCAGGTATGGCT

Proper citation: RRID:Addgene_196340 Copy   

•   Source: Addgene

http://www.addgene.org/242527

Species: E. coli
Genetic Insert: DH10B[lcl857(cro-bioA), araC PBADflpe, PrhaphiC31]
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:

Proper citation: RRID:Addgene_242527 Copy   

•   Source: Addgene

http://www.addgene.org/248174

Species: N/A
Genetic Insert:
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-RiboJ-B0064-Pir4150-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.

Proper citation: RRID:Addgene_248174 Copy   

•   Source: Addgene

http://www.addgene.org/248176

Species: N/A
Genetic Insert:
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, J23117-B0033-PirWT-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.

Proper citation: RRID:Addgene_248176 Copy   

•   Source: Addgene

http://www.addgene.org/237425

Species: n/a
Genetic Insert: none
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir, gyrAR462C To verify the gyrA gene using the following primers: gyrA462-F: cccgtcgtactattttcgaac gyrA462-R: cagcagtcggtcgataaagtc The expected PCR product size is approximately 600 bp. If the strain carries the two characteristic mutations (one silent mutation and one Arg→Cys substitution), it is the correct strain. Please see the GenBank file in the Supplementary Documents section above for reference. Note that the strain is only resistant to low levels of Trimethoprim and Streptomycin. Please see the .PDF in the Supplementary Documents section above. Addgene Note: This strain was prepared directly from the depositor's sample without further sequence verification. We recommend verifying the strain as described above. Please contact [email protected] if any issues arise.

Proper citation: RRID:Addgene_237425 Copy   

•   Source: Addgene

http://www.addgene.org/235121

Species: Other
Genetic Insert:
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Genotype: E. coli B F- ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS) ΔendA ΔrecA glvC ::[ phlFAM, cymRAM, luxR, vanRAM, lacIAM, tetR ] Fast growth at 37C in LB (doubling time ~ 20-25 minutes) and improved DNA (endA, recA) and protein stability (lon, ompT). Strain validation: - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 5 518 bp. - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1160(GCTTGTCGACGACGGC) generates a product of 140 bp. - PCR using OR1157 (TACCCCAGTTGGGGCAC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 110 bp. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.

Proper citation: RRID:Addgene_235121 Copy   

•   Source: Addgene