Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert: Carries a single chromosomal copy of constitutively active PhoP downstream of PcpcG2 promoter inserted in nupG locus
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion.
Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint.
Proper citation: RRID:Addgene_254897 Copy
Species:
Genetic Insert: Carries a single chromosomal copy of the repressor TetR downstream of PcpcG2 promoter inserted in nupG locus
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion.
Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint.
Proper citation: RRID:Addgene_254898 Copy
Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
References:
Comments: To be used with the following plasmids from the Matthews lab: pTARA (www.addgene.org/31491), pLS1 (www.addgene.org/31490), and (www.addgene.org/31492) pLS1/-11
Proper citation: RRID:Addgene_35609 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69778 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69775 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69774 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69782 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69781 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:E. coli BW25113; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:None
References:
Comments: No antibiotic resistance.
Proper citation: RRID:Addgene_72402 Copy
Species:
Genetic Insert: pTet--Cas9 cassette integrated at 186 primary attB site
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_78552 Copy
Species: Mus musculus
Genetic Insert: Forkhead box O1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_83379 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
References:
Comments: To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain Top10. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy.
Proper citation: RRID:Addgene_34928 Copy
Species: E. coli
Genetic Insert: None
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype: λDE3 Δtig100 Δ(araD–araB)567 ΔlacZ4787(::rrnB-3) lacIP-4000(lacIQ) rph-1 Δ(rhaD–rhaB)568 hsdR514
KTD101(DE3) is a λDE3 derivative of the trigger factor deficient (Δtig) strain KTD101 from Puertas et al 2010 Protein Expression and Purification 74: 122–128, PMID 20600941.
Puertas et al 2010 showed that deletion of trigger factor in the parent strain KTD101 increased the level of secreted recombinantly expressed protein. This strain may also improve the level of protein expression in the periplasm and in the outer membrane. This derivative strain KTD101(DE3) now allows expression that is based on the widely-used T7 promoter.
The parent strain KTD101 was provided by François Baneyx at the University of Washington.
DE3 lysogenization is apparent from positive expression that was obtained for the BBA57 protein upon expression from the T7 promoter plasmid pBBA57-TEV-His12, as was shown in Figure S5C, lane 7, of Robertson et al, Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x.
Proper citation: RRID:Addgene_138651 Copy
Species: E. coli
Genetic Insert: bglR, thi-1, rel-1 HfrPO1, ∆nuoA-N
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: Parent strain is 1100, from Humbert et al. 1983 J Bacteriol. doi.org/10.1128/jb.153.1.416-422.1983
Proper citation: RRID:Addgene_186997 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype: E. coli MG1655ΔCRISPR-Cas
Method: Knockout using pKD46/pKD4
Created by: Baiyang Liu
Knockout region from MG1655 genome: 995605 to 1006007
Primer Fw: GATTATCGACTGGGATAACC
Primer Rv: CAGAAATATTCGACAAAGCG
Expected PCR size for JEC027: 1kb
Expected PCR size for MG1655: 10.4kb
Proper citation: RRID:Addgene_180310 Copy
Species:
Genetic Insert: pTet--dCas9 cassette integrated at 186 primary attB site.
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_78551 Copy
Species: Mus musculus
Genetic Insert: FoxO1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None
References:
Comments: To construct pSELECT-HA-mFOXO1 the coding sequence of HA tag and FOXO1 were amplified from pCMV-HA-FOXO1 by PCR. The PCR product was digested with NheI and SalI restriction enzymes and inserted into the NheI and SalI sites of pSELECT-puro.
The insert was sequenced and compared to mouse FOXO1 (NM_019739.3). Sequence identity was confirmed except for a conservative A->G mutation at base 474, a non-conservative A->G mutation at base 1121 and a non-conservative mutation T->C mutation at base 2321 of NM_019739.3. These mutations were confirmed to exist in the original pCMV-HA-FOXO1 plasmid. The non-conservative mutations result in a K->R substitution at amino acid 219 and a L->P substitution at amino acid 619 of mFOXO1 (NP_062713.2).
Mutations at bases 1121 and 2321 were reversed to wild type by site-directed mutagenesis and the corrections were confirmed by sequencing
Proper citation: RRID:Addgene_83308 Copy
Species:
Genetic Insert: None
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
References:
Comments: We recommend growth of the EcAR7 strain at 30 °C in LB supplemented with 0.08% glucose. The EcAR7 strains normally take 1.5-‐2 days to grow at 30°C, after transformation or streaking the strain on an agar plate (with the appropriate antibiotics).
See supplemental information from referenced article for protocol on creating EcAR7 from EcNR2.
Proper citation: RRID:Addgene_52055 Copy
Species:
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: MG1655 + lacIq integrated at intS
Proper citation: RRID:Addgene_60368 Copy
Species:
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: MG1655 + lacIq intergrated at intS + Δ hfq
Proper citation: RRID:Addgene_60369 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.